Ss1.1-mAY1-MI-P-AY1-nrl-d-12-0-UI.s1.3
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TATATATAGGTATGTGTATATGTGTATATATACACACACATATATACATATGGCTGTACT ATCATATAGATCAAACAGCCAAACACCTGGAAGTATTAGATACAAGTTTAAAATATCTTT TATAGGTTTTATATAAAAATGTATGAGTTTGTGTGAAAGTTCTGATACCAGTTGTAATGG ATTCAAATTTATGTGAGCAATAAAGAAGCAATTGGCAGATGTTGGAAA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TATATATAGGTATGTGTATATGTGTATATATACACACACATATATACATATGGCTGTACT ATCATATAGATCAAACAGCCAAACACCTGGAAGTATTAGATACAAGTTTAAAATATCTTT TATAGGTTTTATATAAAAATGTATGAGTTTGTGTGAAAGTTCTGATACCAGTTGTAATGG ATTCAAATTTATGTGAGCAATAAAGAAGCAATTGGCAGATGTTGGAAA |
| Predicted RNA structure(s): 2 entry(ies) | More info |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
| 1-152, - strand, RNAz p=0.999787 | |
| 19-148, - strand, RNAz p=0.940576 |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 1-152, - strand, RNAz p=0.999787 | |
| 19-148, - strand, RNAz p=0.940576 |
| Similar Transcript(s): 12 entry(ies) | More info |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
| 66-148, 602372466F1 NIH_MGC_93 Homo sapiens cDNA clone IMAGE (gb|BG260869.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, 602562187F1 NIH_MGC_61 Homo sapiens cDNA clone IMAGE (gb|BG532617.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, UI-E-EO1-aiw-n-09-0-UI.r1 UI-E-EO1 Homo sapiens cDNA clone (gb|BM729199.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, K-EST0179258 L11SNU354 Homo sapiens cDNA clone L11SNU354-12-F04 5', (gb|CB129592.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, EST12194 human nasopharynx Homo sapiens cDNA, mRNA sequence (gb|CD695671.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, ILLUMIGEN_MCQ_68102 Katze_MMTE Macaca mulatta cDNA clone (gb|DV769280.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, 602372466F1 NIH_MGC_93 Homo sapiens cDNA clone IMAGE (gb|BG260869.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, 602562187F1 NIH_MGC_61 Homo sapiens cDNA clone IMAGE (gb|BG532617.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, UI-E-EO1-aiw-n-09-0-UI.r1 UI-E-EO1 Homo sapiens cDNA clone (gb|BM729199.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, K-EST0179258 L11SNU354 Homo sapiens cDNA clone L11SNU354-12-F04 5', (gb|CB129592.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, EST12194 human nasopharynx Homo sapiens cDNA, mRNA sequence (gb|CD695671.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, ILLUMIGEN_MCQ_68102 Katze_MMTE Macaca mulatta cDNA clone (gb|DV769280.1|), blast E-value=1e-35, identity=98.8% |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
| 66-148, 602372466F1 NIH_MGC_93 Homo sapiens cDNA clone IMAGE (gb|BG260869.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, 602562187F1 NIH_MGC_61 Homo sapiens cDNA clone IMAGE (gb|BG532617.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, UI-E-EO1-aiw-n-09-0-UI.r1 UI-E-EO1 Homo sapiens cDNA clone (gb|BM729199.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, K-EST0179258 L11SNU354 Homo sapiens cDNA clone L11SNU354-12-F04 5', (gb|CB129592.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, EST12194 human nasopharynx Homo sapiens cDNA, mRNA sequence (gb|CD695671.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, ILLUMIGEN_MCQ_68102 Katze_MMTE Macaca mulatta cDNA clone (gb|DV769280.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, 602372466F1 NIH_MGC_93 Homo sapiens cDNA clone IMAGE (gb|BG260869.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, 602562187F1 NIH_MGC_61 Homo sapiens cDNA clone IMAGE (gb|BG532617.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, UI-E-EO1-aiw-n-09-0-UI.r1 UI-E-EO1 Homo sapiens cDNA clone (gb|BM729199.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, K-EST0179258 L11SNU354 Homo sapiens cDNA clone L11SNU354-12-F04 5', (gb|CB129592.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, EST12194 human nasopharynx Homo sapiens cDNA, mRNA sequence (gb|CD695671.1|), blast E-value=1e-35, identity=98.8% | |
| 66-148, ILLUMIGEN_MCQ_68102 Katze_MMTE Macaca mulatta cDNA clone (gb|DV769280.1|), blast E-value=1e-35, identity=98.8% |
| Aligned organism(s): 16 entry(ies) | More info |
| Aligned organism(s): 16 entry(ies) | Help | Less info |
| 1-228, gnl|bosTau2|chr5 (30386376-30386609) | |
| 1-228, gnl|canFam2|chr10 (10820889-10821961) | |
| 1-228, gnl|dasNov1|scaffold_1036 (10497-11541) | |
| 1-228, gnl|echTel1|scaffold_261656 (4853-3712) | |
| 1-228, gnl|galGal2|chr1 (30901622-30902549) | |
| 1-228, gnl|hg17|chr12 (63926809-63927858) | |
| 1-228, gnl|Hg17|chr12 (63927090-63927307) | |
| 1-228, gnl|loxAfr1|scaffold_7793 (26222-27276) | |
| 1-228, gnl|mm7|chr10 (120321200-120320168) | |
| 1-228, gnl|Mm7|chr10 (120320915-120320681) | |
| 1-228, gnl|monDom2|scaffold_354 (89305-88289) | |
| 1-228, gnl|oryCun1|scaffold_207984 (6212-7245) | |
| 1-228, gnl|panTro1|chr10 (65291303-65292351) | |
| 1-228, gnl|rheMac2|chr11 (62295023-62296072) | |
| 1-228, gnl|rn3|chr7 (60252800-60251761) | |
| 1-228, gnl|xenTro1|scaffold_265 (643733-642855) |
| Aligned organism(s): 16 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-228, gnl|bosTau2|chr5 (30386376-30386609) | |
| 1-228, gnl|canFam2|chr10 (10820889-10821961) | |
| 1-228, gnl|dasNov1|scaffold_1036 (10497-11541) | |
| 1-228, gnl|echTel1|scaffold_261656 (4853-3712) | |
| 1-228, gnl|galGal2|chr1 (30901622-30902549) | |
| 1-228, gnl|hg17|chr12 (63926809-63927858) | |
| 1-228, gnl|Hg17|chr12 (63927090-63927307) | |
| 1-228, gnl|loxAfr1|scaffold_7793 (26222-27276) | |
| 1-228, gnl|mm7|chr10 (120321200-120320168) | |
| 1-228, gnl|Mm7|chr10 (120320915-120320681) | |
| 1-228, gnl|monDom2|scaffold_354 (89305-88289) | |
| 1-228, gnl|oryCun1|scaffold_207984 (6212-7245) | |
| 1-228, gnl|panTro1|chr10 (65291303-65292351) | |
| 1-228, gnl|rheMac2|chr11 (62295023-62296072) | |
| 1-228, gnl|rn3|chr7 (60252800-60251761) | |
| 1-228, gnl|xenTro1|scaffold_265 (643733-642855) |