Tra1-TCH01H090036
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| AAAAAAAGAGCCGCCGCCAGCAGAGGGCTGGGCGCAGCGGCCGCGGCCTGGGCGGGCGCA GGGCCGAGCGGACGGGGGGGCGAGGGCCCCCCGGGCGGCCGCGGCCACTCCCCCCCCCCG |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| AAAAAAAGAGCCGCCGCCAGCAGAGGGCTGGGCGCAGCGGCCGCGGCCTGGGCGGGCGCA GGGCCGAGCGGACGGGGGGGCGAGGGCCCCCCGGGCGGCCGCGGCCACTCCCCCCCCCCG |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 8-117, gnl|bosTau2|chr19 (51057811-51057921) | |
| 8-117, gnl|Hg17|chr19 (18253430-18253322) | |
| 8-117, gnl|Mm7|chr8 (69152960-69153087) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 8-117, gnl|bosTau2|chr19 (51057811-51057921) | |
| 8-117, gnl|Hg17|chr19 (18253430-18253322) | |
| 8-117, gnl|Mm7|chr8 (69152960-69153087) |