mAY1-MI-P-AY1-nrd-d-04-0-UI.s1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CAAATATAGTGTCCCACCTTGAGGTCCTAGCACTTAAGTGGCTCCTCGCTGCCACCGGCG GCAGCTCCCCAAGGTCCAGTGGTGGCTGATATGAACCACAGGACACCGAGGAACCGGGCG GCCACTGTGTCGGGAGCAGCCGGCCTGGAGGCCCAGGCGGCCGC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CAAATATAGTGTCCCACCTTGAGGTCCTAGCACTTAAGTGGCTCCTCGCTGCCACCGGCG GCAGCTCCCCAAGGTCCAGTGGTGGCTGATATGAACCACAGGACACCGAGGAACCGGGCG GCCACTGTGTCGGGAGCAGCCGGCCTGGAGGCCCAGGCGGCCGC |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 54-164, - strand, RNAz p=0.714217 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 54-164, - strand, RNAz p=0.714217 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 45-131, - strand, RNAmicro p=0.988303 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 6-164, gnl|bosTau2|chr3 (56418404-56418562) | |
| 6-164, gnl|Hg17|chr1 (61902646-61902810) | |
| 6-164, gnl|Mm7|chr4 (97775673-97775840) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 6-164, gnl|bosTau2|chr3 (56418404-56418562) | |
| 6-164, gnl|Hg17|chr1 (61902646-61902810) | |
| 6-164, gnl|Mm7|chr4 (97775673-97775840) |