Non-Coding RNA Search

mCP1-MI-P-CP1-nwe-b-01-0-UI.s1

Sequence:


               
               TATCCAAATATTCCACCTAATAAGGACATAGGTTATCCTGGACTGGGTAACCACTCTGCA
ACATTCCTGAGAATTGAATAATATAATAATCTTGAAAGTCAGCAGAGTGGATTATCCACT
TTTTTTTTCTGGACTTGAACTTGTGACCTTAACAGTAGCACTGCCAAAAAAAAAAAAAAA
AAA

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               TATCCAAATATTCCACCTAATAAGGACATAGGTTATCCTGGACTGGGTAACCACTCTGCA
ACATTCCTGAGAATTGAATAATATAATAATCTTGAAAGTCAGCAGAGTGGATTATCCACT
TTTTTTTTCTGGACTTGAACTTGTGACCTTAACAGTAGCACTGCCAAAAAAAAAAAAAAA
AAA

Predicted RNA structure(s): 1 entry(ies)

More info

Predicted RNA structure(s): 1 entry(ies)

Help | Less info


               
               1-155, - strand, RNAz p=0.994789

Predicted RNA structure(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               1-155, - strand, RNAz p=0.994789

Predicted microRNA(s): 2 entry(ies)

More info

Predicted microRNA(s): 2 entry(ies)

Help | Less info


               
               23-179, - strand, RNAmicro p=0.999815
               

               
               44-116, + strand, RNAmicro p=0.945965

Predicted microRNA(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro


               
               23-179, - strand, RNAmicro p=0.999815
               

               
               44-116, + strand, RNAmicro p=0.945965

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               1-119, as90g03.x1 Barstead colon HPLRB7 Homo sapiens cDNA clone 
(gb|AI707471.1|), blast E-value=6e-38, identity=92.44% 
               

               
               1-155, nab57a10.x1 Soares_NSF_F8_9W_OT_PA_P_S1 Homo sapiens cDNA clone 
(gb|BF438972.1|), blast E-value=1e-38, identity=87.1% 
               

               
               1-155, UI-CF-EC1-aci-n-21-0-UI.s1 UI-CF-EC1 Homo sapiens cDNA clone 
(gb|BU682835.1|), blast E-value=1e-38, identity=87.1% 
               

               
               1-155, NISC_gm08e11.x1 NCI_CGAP_Brn23 Homo sapiens cDNA clone (gb|CB055214.1|), 
blast E-value=1e-38, identity=87.1% 
               

               
               1-155, NISC_gm08e11.y1 NCI_CGAP_Brn23 Homo sapiens cDNA clone (gb|CB055215.1|), 
blast E-value=1e-38, identity=87.1% 
               

               
               1-155, yj52b11.r1 Soares breast 2NbHBst Homo sapiens cDNA clone (gb|R46513.1|), 
blast E-value=1e-38, identity=87.1%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               1-119, as90g03.x1 Barstead colon HPLRB7 Homo sapiens cDNA clone 
(gb|AI707471.1|), blast E-value=6e-38, identity=92.44% 
               

               
               1-155, nab57a10.x1 Soares_NSF_F8_9W_OT_PA_P_S1 Homo sapiens cDNA clone 
(gb|BF438972.1|), blast E-value=1e-38, identity=87.1% 
               

               
               1-155, UI-CF-EC1-aci-n-21-0-UI.s1 UI-CF-EC1 Homo sapiens cDNA clone 
(gb|BU682835.1|), blast E-value=1e-38, identity=87.1% 
               

               
               1-155, NISC_gm08e11.x1 NCI_CGAP_Brn23 Homo sapiens cDNA clone (gb|CB055214.1|), 
blast E-value=1e-38, identity=87.1% 
               

               
               1-155, NISC_gm08e11.y1 NCI_CGAP_Brn23 Homo sapiens cDNA clone (gb|CB055215.1|), 
blast E-value=1e-38, identity=87.1% 
               

               
               1-155, yj52b11.r1 Soares breast 2NbHBst Homo sapiens cDNA clone (gb|R46513.1|), 
blast E-value=1e-38, identity=87.1%

Aligned organism(s): 3 entry(ies)

More info

Aligned organism(s): 3 entry(ies)

Help | Less info


               
               1-177, gnl|bosTau2|chr13 (32143091-32142911)
               

               
               1-177, gnl|Hg17|chr20 (6708394-6708220)
               

               
               1-177, gnl|Mm7|chr2 (133303231-133303051)

Aligned organism(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               1-177, gnl|bosTau2|chr13 (32143091-32142911)
               

               
               1-177, gnl|Hg17|chr20 (6708394-6708220)
               

               
               1-177, gnl|Mm7|chr2 (133303231-133303051)

	23-179, - strand, RNAmicro p=0.999815
	44-116, + strand, RNAmicro p=0.945965

	1-119, as90g03.x1 Barstead colon HPLRB7 Homo sapiens cDNA clone (gb\|AI707471.1\|), blast E-value=6e-38, identity=92.44%
	1-155, nab57a10.x1 Soares_NSF_F8_9W_OT_PA_P_S1 Homo sapiens cDNA clone (gb\|BF438972.1\|), blast E-value=1e-38, identity=87.1%
	1-155, UI-CF-EC1-aci-n-21-0-UI.s1 UI-CF-EC1 Homo sapiens cDNA clone (gb\|BU682835.1\|), blast E-value=1e-38, identity=87.1%
	1-155, NISC_gm08e11.x1 NCI_CGAP_Brn23 Homo sapiens cDNA clone (gb\|CB055214.1\|), blast E-value=1e-38, identity=87.1%
	1-155, NISC_gm08e11.y1 NCI_CGAP_Brn23 Homo sapiens cDNA clone (gb\|CB055215.1\|), blast E-value=1e-38, identity=87.1%
	1-155, yj52b11.r1 Soares breast 2NbHBst Homo sapiens cDNA clone (gb\|R46513.1\|), blast E-value=1e-38, identity=87.1%

	1-177, gnl\|bosTau2\|chr13 (32143091-32142911)
	1-177, gnl\|Hg17\|chr20 (6708394-6708220)
	1-177, gnl\|Mm7\|chr2 (133303231-133303051)