Non-Coding RNA Search

mE3-MI-P-E3-aam-b-09-1-UM.s1

Sequence:


               
               CCCGTGGACCCTGAGACCTCCAGCTCCCTGGGCACCGTGATAGTGGTTGTCCTGGCTCCC
CGCCTTGCCCATGACTTCACCNCCGGATGTGCAGGCTGCTTTTCAGAAGGTGGTGGCTGG
TGTGGCCAATGCCCTGGCCCACAAGTACCACTAAGTTCCCCTTCCTGATTTCCAGGAGGA
GCCCTTTTTCCTCTGAACCCAAAAACTGGATATGGAAATATTTTGAAGAGTTTTGAGCAT
CTGGCCTCTGCGTAATAAAAACATTTATTTTCATTGCAAAAAAAAAAAAAAAA

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               CCCGTGGACCCTGAGACCTCCAGCTCCCTGGGCACCGTGATAGTGGTTGTCCTGGCTCCC
CGCCTTGCCCATGACTTCACCNCCGGATGTGCAGGCTGCTTTTCAGAAGGTGGTGGCTGG
TGTGGCCAATGCCCTGGCCCACAAGTACCACTAAGTTCCCCTTCCTGATTTCCAGGAGGA
GCCCTTTTTCCTCTGAACCCAAAAACTGGATATGGAAATATTTTGAAGAGTTTTGAGCAT
CTGGCCTCTGCGTAATAAAAACATTTATTTTCATTGCAAAAAAAAAAAAAAAA

Predicted RNA structure(s): 1 entry(ies)

More info

Predicted RNA structure(s): 1 entry(ies)

Help | Less info


               
               100-212, - strand, RNAz p=0.999616

Predicted RNA structure(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               100-212, - strand, RNAz p=0.999616

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               100-212, DB804937 full-length enriched swine cDNA library, adult skin Sus 
(dbj|DB804937.1|), blast E-value=0, identity=100% 
               

               
               100-212, DB804946 full-length enriched swine cDNA library, adult skin Sus 
(dbj|DB804946.1|), blast E-value=0, identity=100% 
               

               
               100-212, DB805017 full-length enriched swine cDNA library, adult skin Sus 
(dbj|DB805017.1|), blast E-value=0, identity=100% 
               

               
               100-212, DB805165 full-length enriched swine cDNA library, adult skin Sus 
(dbj|DB805165.1|), blast E-value=0, identity=100% 
               

               
               100-212, DB816255 full-length enriched swine cDNA library, adult periphral 
(dbj|DB816255.1|), blast E-value=0, identity=100% 
               

               
               100-212, DB816364 full-length enriched swine cDNA library, adult periphral 
(dbj|DB816364.1|), blast E-value=0, identity=100%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               100-212, DB804937 full-length enriched swine cDNA library, adult skin Sus 
(dbj|DB804937.1|), blast E-value=0, identity=100% 
               

               
               100-212, DB804946 full-length enriched swine cDNA library, adult skin Sus 
(dbj|DB804946.1|), blast E-value=0, identity=100% 
               

               
               100-212, DB805017 full-length enriched swine cDNA library, adult skin Sus 
(dbj|DB805017.1|), blast E-value=0, identity=100% 
               

               
               100-212, DB805165 full-length enriched swine cDNA library, adult skin Sus 
(dbj|DB805165.1|), blast E-value=0, identity=100% 
               

               
               100-212, DB816255 full-length enriched swine cDNA library, adult periphral 
(dbj|DB816255.1|), blast E-value=0, identity=100% 
               

               
               100-212, DB816364 full-length enriched swine cDNA library, adult periphral 
(dbj|DB816364.1|), blast E-value=0, identity=100%

Aligned organism(s): 2 entry(ies)

More info

Aligned organism(s): 2 entry(ies)

Help | Less info


               
               21-278, gnl|bosTau2|chr15 (31549091-31549347)
               

               
               21-278, gnl|Mm7|chr7 (99882775-99882512)

Aligned organism(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               21-278, gnl|bosTau2|chr15 (31549091-31549347)
               

               
               21-278, gnl|Mm7|chr7 (99882775-99882512)

	100-212, DB804937 full-length enriched swine cDNA library, adult skin Sus (dbj\|DB804937.1\|), blast E-value=0, identity=100%
	100-212, DB804946 full-length enriched swine cDNA library, adult skin Sus (dbj\|DB804946.1\|), blast E-value=0, identity=100%
	100-212, DB805017 full-length enriched swine cDNA library, adult skin Sus (dbj\|DB805017.1\|), blast E-value=0, identity=100%
	100-212, DB805165 full-length enriched swine cDNA library, adult skin Sus (dbj\|DB805165.1\|), blast E-value=0, identity=100%
	100-212, DB816255 full-length enriched swine cDNA library, adult periphral (dbj\|DB816255.1\|), blast E-value=0, identity=100%
	100-212, DB816364 full-length enriched swine cDNA library, adult periphral (dbj\|DB816364.1\|), blast E-value=0, identity=100%

	21-278, gnl\|bosTau2\|chr15 (31549091-31549347)
	21-278, gnl\|Mm7\|chr7 (99882775-99882512)