mE3-MI-P-E3-aam-b-09-1-UM.s1
|
CCCGTGGACCCTGAGACCTCCAGCTCCCTGGGCACCGTGATAGTGGTTGTCCTGGCTCCC
CGCCTTGCCCATGACTTCACCNCCGGATGTGCAGGCTGCTTTTCAGAAGGTGGTGGCTGG
TGTGGCCAATGCCCTGGCCCACAAGTACCACTAAGTTCCCCTTCCTGATTTCCAGGAGGA
GCCCTTTTTCCTCTGAACCCAAAAACTGGATATGGAAATATTTTGAAGAGTTTTGAGCAT
CTGGCCTCTGCGTAATAAAAACATTTATTTTCATTGCAAAAAAAAAAAAAAAA
|
Blue-coloured subsequences are predicted RNA structures by RNAz
|
CCCGTGGACCCTGAGACCTCCAGCTCCCTGGGCACCGTGATAGTGGTTGTCCTGGCTCCC
CGCCTTGCCCATGACTTCACCNCCGGATGTGCAGGCTGCTTTTCAGAAGGTGGTGGCTGG
TGTGGCCAATGCCCTGGCCCACAAGTACCACTAAGTTCCCCTTCCTGATTTCCAGGAGGA
GCCCTTTTTCCTCTGAACCCAAAAACTGGATATGGAAATATTTTGAAGAGTTTTGAGCAT
CTGGCCTCTGCGTAATAAAAACATTTATTTTCATTGCAAAAAAAAAAAAAAAA
|
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
|
100-212, DB804937 full-length enriched swine cDNA library, adult skin Sus
(dbj|DB804937.1|), blast E-value=0, identity=100% |
|
100-212, DB804946 full-length enriched swine cDNA library, adult skin Sus
(dbj|DB804946.1|), blast E-value=0, identity=100% |
|
100-212, DB805017 full-length enriched swine cDNA library, adult skin Sus
(dbj|DB805017.1|), blast E-value=0, identity=100% |
|
100-212, DB805165 full-length enriched swine cDNA library, adult skin Sus
(dbj|DB805165.1|), blast E-value=0, identity=100% |
|
100-212, DB816255 full-length enriched swine cDNA library, adult periphral
(dbj|DB816255.1|), blast E-value=0, identity=100% |
|
100-212, DB816364 full-length enriched swine cDNA library, adult periphral
(dbj|DB816364.1|), blast E-value=0, identity=100% |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
|
100-212, DB804937 full-length enriched swine cDNA library, adult skin Sus
(dbj|DB804937.1|), blast E-value=0, identity=100% |
|
100-212, DB804946 full-length enriched swine cDNA library, adult skin Sus
(dbj|DB804946.1|), blast E-value=0, identity=100% |
|
100-212, DB805017 full-length enriched swine cDNA library, adult skin Sus
(dbj|DB805017.1|), blast E-value=0, identity=100% |
|
100-212, DB805165 full-length enriched swine cDNA library, adult skin Sus
(dbj|DB805165.1|), blast E-value=0, identity=100% |
|
100-212, DB816255 full-length enriched swine cDNA library, adult periphral
(dbj|DB816255.1|), blast E-value=0, identity=100% |
|
100-212, DB816364 full-length enriched swine cDNA library, adult periphral
(dbj|DB816364.1|), blast E-value=0, identity=100% |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map