mE4-MI-P-E4-ahf-c-02-1-UM.s1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| AAACCTTGGAGAGAAGTTAACAGATGAAGAGGTTGATGAAATGATCAGGGAAGCAGATAT TGATGGTGATGGTCAAGTAAACTATGAAGAGTTTGTACAAATGATGACAGCAAAGTGAAG ACGTTGTACAGAATGTGTTAAATTTCTTGTACAAAATGTTTATTTCCTTTTCTTTGTTTG TAACTTATCTGTAAAAGGTTTCCCCTACTGTCAAAAAAAAAAAAAAAAAA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| AAACCTTGGAGAGAAGTTAACAGATGAAGAGGTTGATGAAATGATCAGGGAAGCAGATAT TGATGGTGATGGTCAAGTAAACTATGAAGAGTTTGTACAAATGATGACAGCAAAGTGAAG ACGTTGTACAGAATGTGTTAAATTTCTTGTACAAAATGTTTATTTCCTTTTCTTTGTTTG TAACTTATCTGTAAAAGGTTTCCCCTACTGTCAAAAAAAAAAAAAAAAAA |
| Coded protein: 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 104-218, - strand, RNAz p=0.97777 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 104-218, - strand, RNAz p=0.97777 |
| Aligned organism(s): 6 entry(ies) | More info |
| Aligned organism(s): 6 entry(ies) | Help | Less info |
| 1-224, gnl|bosTau2|chr18 (40054941-40055167) | |
| 1-224, gnl|Hg17|chr10 (71593777-71593995) | |
| 1-224, gnl|Mm7|chrX (43102604-43102825) | |
| 42-218, gnl|bosTau2|chr12 (22350585-22350760) | |
| 42-218, gnl|Hg17|chr2 (47300560-47299463) | |
| 42-218, gnl|Mm7|chrX (43102645-43102823) |
| Aligned organism(s): 6 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-224, gnl|bosTau2|chr18 (40054941-40055167) | |
| 1-224, gnl|Hg17|chr10 (71593777-71593995) | |
| 1-224, gnl|Mm7|chrX (43102604-43102825) | |
| 42-218, gnl|bosTau2|chr12 (22350585-22350760) | |
| 42-218, gnl|Hg17|chr2 (47300560-47299463) | |
| 42-218, gnl|Mm7|chrX (43102645-43102823) |