mO3-MI-P-O3-aaz-g-07-1-UM.s1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GCTCGACTCACCCCCCACATGAGTTCTCCCTCCCACACTGCGCTGATCCCTACTGAAAAA GAGCAGATTGTTCCTCACCCAGAAGAGGAGGTTCCACAGAAGAAAAAGATCTCCCAGAAG AAACTGAAGAAGCAAAAACTTATGGCCCGGGAATAAATTTCACAAAAATAAATGCAAATC ATAGTAAAAAAAAAAAAAAAAAA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GCTCGACTCACCCCCCACATGAGTTCTCCCTCCCACACTGCGCTGATCCCTACTGAAAAA GAGCAGATTGTTCCTCACCCAGAAGAGGAGGTTCCACAGAAGAAAAAGATCTCCCAGAAG AAACTGAAGAAGCAAAAACTTATGGCCCGGGAATAAATTTCACAAAAATAAATGCAAATC ATAGTAAAAAAAAAAAAAAAAAA |
| Coded protein: 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 42-161, - strand, RNAz p=0.533708 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 42-161, - strand, RNAz p=0.533708 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 3-203, gnl|bosTau2|chr8 (61568383-61568584) | |
| 3-203, gnl|Hg17|chr3 (199065734-199065533) | |
| 3-203, gnl|Mm7|chr18 (38621430-38621627) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 3-203, gnl|bosTau2|chr8 (61568383-61568584) | |
| 3-203, gnl|Hg17|chr3 (199065734-199065533) | |
| 3-203, gnl|Mm7|chr18 (38621430-38621627) |