unkn-MI-P-AY0-neu-d-02-0-UI.s1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TTTTTTTTTTTTTTTTTAACGGCCCCAGTCAACGAAAGGGAAACTTTATTGAGGCCCCAG GGCCATGGGGCTTGGGCAAGAGGCTGCCCTGCAAACAAAGGAAAAGCTGGGGGAAAGGGC TTATTTGACCTTCTTCTTGGGGCGCAAGTTGTTGGTGTGGCCAAACTT |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TTTTTTTTTTTTTTTTTAACGGCCCCAGTCAACGAAAGGGAAACTTTATTGAGGCCCCAG GGCCATGGGGCTTGGGCAAGAGGCTGCCCTGCAAACAAAGGAAAAGCTGGGGGAAAGGGC TTATTTGACCTTCTTCTTGGGGCGCAAGTTGTTGGTGTGGCCAAACTT |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 19-138, + strand, RNAz p=0.714516 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 19-138, + strand, RNAz p=0.714516 |
| Aligned organism(s): 2 entry(ies) | More info |
| Aligned organism(s): 2 entry(ies) | Help | Less info |
| 19-168, gnl|bosTau2|chr7 (2026746-2026598) | |
| 19-168, gnl|Hg17|chr19 (18547049-18546913) |
| Aligned organism(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 19-168, gnl|bosTau2|chr7 (2026746-2026598) | |
| 19-168, gnl|Hg17|chr19 (18547049-18546913) |