unkn-SGD602702212.R1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TTTTTTTTGAAAAGCACTTAACATTTAATGAAGTTTCCCAGCATGTGGCTTCAAGCCACC AGGACACAAGCCCCACCTACACCCTTAATCTTCTCCTCAGCTCTTCTGCTGAAGAATTTG GCCTTCACGATGACAGGCTGCTTTGGGAGCTTTCCTTTCCCTCGAGCC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TTTTTTTTGAAAAGCACTTAACATTTAATGAAGTTTCCCAGCATGTGGCTTCAAGCCACC AGGACACAAGCCCCACCTACACCCTTAATCTTCTCCTCAGCTCTTCTGCTGAAGAATTTG GCCTTCACGATGACAGGCTGCTTTGGGAGCTTTCCTTTCCCTCGAGCC |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 3-161, - strand, RNAz p=0.973886 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 3-161, - strand, RNAz p=0.973886 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 3-161, gnl|bosTau2|chr18 (53549783-53549626) | |
| 3-161, gnl|Hg17|chr6 (153695491-153695646) | |
| 3-161, gnl|Mm7|chr3 (24147885-24147731) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 3-161, gnl|bosTau2|chr18 (53549783-53549626) | |
| 3-161, gnl|Hg17|chr6 (153695491-153695646) | |
| 3-161, gnl|Mm7|chr3 (24147885-24147731) |