Non-Coding RNA Search

Ss1.1-4cip-UMC-p4civp1-004-c02.3

Sequence:


               
               CTCATTTCAGGCAAAGAGAGCTCGACTTAACAAGATTACTGGTTTGTTGGCATCCAAAGC
TGTTGGGGTGGATGGTGCTGAAAAAAAGGAAGACTACAATGAAACGGCTCCAATGCTGGA
GCAGGTATACAGATAAACTACAGACTTCATTAGTGTTTGTTTTCAATAGACTGGAATTAA
AGCCTTTGTCTCCAACGTTTGAAAGCCTGGAGACAGGCATCCCAGGGTATATAGGCTTTC
AGCTGGATCACCTTTAACTAGCTTACAAAAAGACCCTTACACAAATACTTTTCATTTGTG
AGTTAAAACAGGGTTTTTGACATCTAATAAAGCTTC

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               CTCATTTCAGGCAAAGAGAGCTCGACTTAACAAGATTACTGGTTTGTTGGCATCCAAAGC
TGTTGGGGTGGATGGTGCTGAAAAAAAGGAAGACTACAATGAAACGGCTCCAATGCTGGA
GCAGGTATACAGATAAACTACAGACTTCATTAGTGTTTGTTTTCAATAGACTGGAATTAA
AGCCTTTGTCTCCAACGTTTGAAAGCCTGGAGACAGGCATCCCAGGGTATATAGGCTTTC
AGCTGGATCACCTTTAACTAGCTTACAAAAAGACCCTTACACAAATACTTTTCATTTGTG
AGTTAAAACAGGGTTTTTGACATCTAATAAAGCTTC

Predicted RNA structure(s): 1 entry(ies)

More info

Predicted RNA structure(s): 1 entry(ies)

Help | Less info


               
               124-336, + strand, RNAz p=0.998304

Predicted RNA structure(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               124-336, + strand, RNAz p=0.998304

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               166-318, BB338473 RIKEN full-length enriched, 10 days neonate cerebellum Mus 
(dbj|BB338473.2|), blast E-value=7e-20, identity=84.97% 
               

               
               166-318, CJ313953 RIKEN full-length enriched mouse cDNA library, Rathke's 
(dbj|CJ313953.1|), blast E-value=7e-20, identity=84.97% 
               

               
               166-318, CJ320843 RIKEN full-length enriched mouse cDNA library, Rathke's 
(dbj|CJ320843.1|), blast E-value=7e-20, identity=84.97% 
               

               
               166-318, CJ323316 RIKEN full-length enriched mouse cDNA library, Rathke's 
(dbj|CJ323316.1|), blast E-value=7e-20, identity=84.97% 
               

               
               166-318, CJ323317 RIKEN full-length enriched mouse cDNA library, Rathke's 
(dbj|CJ323317.1|), blast E-value=7e-20, identity=84.97% 
               

               
               124-336, K-EST0182933 L9SNU354 Homo sapiens cDNA clone L9SNU354-9-A12 5', 
(gb|CB132531.1|), blast E-value=0, identity=93.9%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               166-318, BB338473 RIKEN full-length enriched, 10 days neonate cerebellum Mus 
(dbj|BB338473.2|), blast E-value=7e-20, identity=84.97% 
               

               
               166-318, CJ313953 RIKEN full-length enriched mouse cDNA library, Rathke's 
(dbj|CJ313953.1|), blast E-value=7e-20, identity=84.97% 
               

               
               166-318, CJ320843 RIKEN full-length enriched mouse cDNA library, Rathke's 
(dbj|CJ320843.1|), blast E-value=7e-20, identity=84.97% 
               

               
               166-318, CJ323316 RIKEN full-length enriched mouse cDNA library, Rathke's 
(dbj|CJ323316.1|), blast E-value=7e-20, identity=84.97% 
               

               
               166-318, CJ323317 RIKEN full-length enriched mouse cDNA library, Rathke's 
(dbj|CJ323317.1|), blast E-value=7e-20, identity=84.97% 
               

               
               124-336, K-EST0182933 L9SNU354 Homo sapiens cDNA clone L9SNU354-9-A12 5', 
(gb|CB132531.1|), blast E-value=0, identity=93.9%

Homologous human UTR: 1 entry(ies)

More info

Homologous human UTR: 1 entry(ies)

Help | Less info


               
               3' of NM_024878, +

Homologous human UTR: 1 entry(ies)

Help | Less info

Human gene identifier and UTR site,
human gene reading direction


               
               3' of NM_024878, +

Aligned organism(s): 3 entry(ies)

More info

Aligned organism(s): 3 entry(ies)

Help | Less info


               
               124-336, gnl|bosTau2|chr14 (4410414-4410626)
               

               
               124-336, gnl|Hg17|chr8 (133892708-133892917)
               

               
               124-336, gnl|Mm7|chr15 (66693300-66693506)

Aligned organism(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               124-336, gnl|bosTau2|chr14 (4410414-4410626)
               

               
               124-336, gnl|Hg17|chr8 (133892708-133892917)
               

               
               124-336, gnl|Mm7|chr15 (66693300-66693506)

Expressed library(ies): 1 entry(ies)

More info

Expressed library(ies): 1 entry(ies)

Help | Less info


               
               csk (0.140746)

Expressed library(ies): 1 entry(ies)

Help | Less info

Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description


               
               csk (0.140746)

	166-318, BB338473 RIKEN full-length enriched, 10 days neonate cerebellum Mus (dbj\|BB338473.2\|), blast E-value=7e-20, identity=84.97%
	166-318, CJ313953 RIKEN full-length enriched mouse cDNA library, Rathke's (dbj\|CJ313953.1\|), blast E-value=7e-20, identity=84.97%
	166-318, CJ320843 RIKEN full-length enriched mouse cDNA library, Rathke's (dbj\|CJ320843.1\|), blast E-value=7e-20, identity=84.97%
	166-318, CJ323316 RIKEN full-length enriched mouse cDNA library, Rathke's (dbj\|CJ323316.1\|), blast E-value=7e-20, identity=84.97%
	166-318, CJ323317 RIKEN full-length enriched mouse cDNA library, Rathke's (dbj\|CJ323317.1\|), blast E-value=7e-20, identity=84.97%
	124-336, K-EST0182933 L9SNU354 Homo sapiens cDNA clone L9SNU354-9-A12 5', (gb\|CB132531.1\|), blast E-value=0, identity=93.9%

	124-336, gnl\|bosTau2\|chr14 (4410414-4410626)
	124-336, gnl\|Hg17\|chr8 (133892708-133892917)
	124-336, gnl\|Mm7\|chr15 (66693300-66693506)