Ss1.1-LyN1-MLN01B100087.5
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CTCCCGCCGAGTTGGAGACGGATGGGCTGGGACGGGTTTGGGGGGGGTGTCCCCAGTTCT GACTGGGAGTGGAGGAACCCCCTCCTGTGCTCTCTTGTGGGGGTCCCCCCTCCCTAGGGC ACTCCCCACTCCCTGAGCCAGCCGAGAGGAAGGAGGCCAGCGATGCGACTGGGGCGGCTC CTTTCTCCTGCACCCCAAATGTGAGGGATGCACCCCAAAATTTGTTCCCTTCATAATAGG GGACCAGGATCTCAGGGGAGAGTAGCTGAGGCAGGCCTTGCTCAGAGTCCCAGGCGGTCC ACAGGTCCAGGGTGAACAGTGACAGGGGTCAGAGGTGGCAGGCTCAGCAAGAGAGCAGAG GAGGATCAGCAGAGGTCAGAAGAAGGCCAGAATCCAGGGTCAGGCTGTCTGGAACAGGAA GTGAAACGGGCCGAGATGGAGCGAGCCCCAAGGTGGCCTCCGAGACGACCCCGACCTCCC GGAGCAGCGGGCACCTGACAGACCCTGCGTGCACAGGAGGGAACCTTCTCTTCCAAAGCC CAGGGGGGGACCCCCGGCCTCGGGGGCACTGGAGCTGCTTGGTGGAGGGGCAGCCGGAGG AGGCGACAAGACGCCAGATGCCACCTTCTTGGGCCCTTTCTTGGGCGAATCAGCCGGAAG GGGGATGCCGGAGTCTTCGTATAC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CTCCCGCCGAGTTGGAGACGGATGGGCTGGGACGGGTTTGGGGGGGGTGTCCCCAGTTCT GACTGGGAGTGGAGGAACCCCCTCCTGTGCTCTCTTGTGGGGGTCCCCCCTCCCTAGGGC ACTCCCCACTCCCTGAGCCAGCCGAGAGGAAGGAGGCCAGCGATGCGACTGGGGCGGCTC CTTTCTCCTGCACCCCAAATGTGAGGGATGCACCCCAAAATTTGTTCCCTTCATAATAGG GGACCAGGATCTCAGGGGAGAGTAGCTGAGGCAGGCCTTGCTCAGAGTCCCAGGCGGTCC ACAGGTCCAGGGTGAACAGTGACAGGGGTCAGAGGTGGCAGGCTCAGCAAGAGAGCAGAG GAGGATCAGCAGAGGTCAGAAGAAGGCCAGAATCCAGGGTCAGGCTGTCTGGAACAGGAA GTGAAACGGGCCGAGATGGAGCGAGCCCCAAGGTGGCCTCCGAGACGACCCCGACCTCCC GGAGCAGCGGGCACCTGACAGACCCTGCGTGCACAGGAGGGAACCTTCTCTTCCAAAGCC CAGGGGGGGACCCCCGGCCTCGGGGGCACTGGAGCTGCTTGGTGGAGGGGCAGCCGGAGG AGGCGACAAGACGCCAGATGCCACCTTCTTGGGCCCTTTCTTGGGCGAATCAGCCGGAAG GGGGATGCCGGAGTCTTCGTATAC |
| Coded protein: 1 entry(ies) | More info |
| Predicted RNA structure(s): 2 entry(ies) | More info |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
| 1-158, + strand, RNAz p=0.991671 | |
| 6-271, - strand, RNAz p=0.998212 |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 1-158, + strand, RNAz p=0.991671 | |
| 6-271, - strand, RNAz p=0.998212 |
| Predicted microRNA(s): 2 entry(ies) | More info |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
| 26-98, + strand, RNAmicro p=0.999658 | |
| 99-236, - strand, RNAmicro p=0.986723 |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 26-98, + strand, RNAmicro p=0.999658 | |
| 99-236, - strand, RNAmicro p=0.986723 |
| Similar Transcript(s): 12 entry(ies) | More info |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
| 1-158, BP165621 full-length enriched swine cDNA library, adult thymus Sus (dbj|BP165621.1|), blast E-value=0, identity=94.94% | |
| 1-158, CJ014585 full-length enriched swine cDNA library, adult mesenteric (dbj|CJ014585.1|), blast E-value=0, identity=94.3% | |
| 1-158, CJ028944 full-length enriched swine cDNA library, adult trachea Sus (dbj|CJ028944.1|), blast E-value=0, identity=94.94% | |
| 1-158, DA285925 BRCOC2 Homo sapiens cDNA clone BRCOC2016506 5', mRNA (dbj|DA285925.1|), blast E-value=0, identity=90.51% | |
| 20-158, AGENCOURT_6507030 NIH_MGC_124 Homo sapiens cDNA clone IMAGE (gb|BM547696.1|), blast E-value=6e-38, identity=89.21% | |
| 19-158, ILLUMIGEN_MCQ_67042 Katze_MMOV Macaca mulatta cDNA clone (gb|DR771788.1|), blast E-value=5.99994e-41, identity=90% | |
| 6-271, BP165621 full-length enriched swine cDNA library, adult thymus Sus (dbj|BP165621.1|), blast E-value=0, identity=96.99% | |
| 6-271, CJ014585 full-length enriched swine cDNA library, adult mesenteric (dbj|CJ014585.1|), blast E-value=0, identity=96.62% | |
| 6-271, CJ028944 full-length enriched swine cDNA library, adult trachea Sus (dbj|CJ028944.1|), blast E-value=0, identity=96.62% | |
| 6-271, DA285925 BRCOC2 Homo sapiens cDNA clone BRCOC2016506 5', mRNA (dbj|DA285925.1|), blast E-value=0, identity=91.73% | |
| 20-271, AGENCOURT_6507030 NIH_MGC_124 Homo sapiens cDNA clone IMAGE (gb|BM547696.1|), blast E-value=0, identity=91.27% | |
| 19-269, ILLUMIGEN_MCQ_67042 Katze_MMOV Macaca mulatta cDNA clone (gb|DR771788.1|), blast E-value=0, identity=90.44% |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
| 1-158, BP165621 full-length enriched swine cDNA library, adult thymus Sus (dbj|BP165621.1|), blast E-value=0, identity=94.94% | |
| 1-158, CJ014585 full-length enriched swine cDNA library, adult mesenteric (dbj|CJ014585.1|), blast E-value=0, identity=94.3% | |
| 1-158, CJ028944 full-length enriched swine cDNA library, adult trachea Sus (dbj|CJ028944.1|), blast E-value=0, identity=94.94% | |
| 1-158, DA285925 BRCOC2 Homo sapiens cDNA clone BRCOC2016506 5', mRNA (dbj|DA285925.1|), blast E-value=0, identity=90.51% | |
| 20-158, AGENCOURT_6507030 NIH_MGC_124 Homo sapiens cDNA clone IMAGE (gb|BM547696.1|), blast E-value=6e-38, identity=89.21% | |
| 19-158, ILLUMIGEN_MCQ_67042 Katze_MMOV Macaca mulatta cDNA clone (gb|DR771788.1|), blast E-value=5.99994e-41, identity=90% | |
| 6-271, BP165621 full-length enriched swine cDNA library, adult thymus Sus (dbj|BP165621.1|), blast E-value=0, identity=96.99% | |
| 6-271, CJ014585 full-length enriched swine cDNA library, adult mesenteric (dbj|CJ014585.1|), blast E-value=0, identity=96.62% | |
| 6-271, CJ028944 full-length enriched swine cDNA library, adult trachea Sus (dbj|CJ028944.1|), blast E-value=0, identity=96.62% | |
| 6-271, DA285925 BRCOC2 Homo sapiens cDNA clone BRCOC2016506 5', mRNA (dbj|DA285925.1|), blast E-value=0, identity=91.73% | |
| 20-271, AGENCOURT_6507030 NIH_MGC_124 Homo sapiens cDNA clone IMAGE (gb|BM547696.1|), blast E-value=0, identity=91.27% | |
| 19-269, ILLUMIGEN_MCQ_67042 Katze_MMOV Macaca mulatta cDNA clone (gb|DR771788.1|), blast E-value=0, identity=90.44% |
| Aligned organism(s): 10 entry(ies) | More info |
| Aligned organism(s): 10 entry(ies) | Help | Less info |
| 1-271, gnl|bosTau2|chr19 (14664047-14663776) | |
| 1-271, gnl|canFam2|chr5 (35043705-35044057) | |
| 1-271, gnl|hg17|chr17 (6863364-6863716) | |
| 1-271, gnl|Hg17|chr17 (6863689-6863420) | |
| 1-271, gnl|mm7|chr11 (70315016-70314665) | |
| 1-271, gnl|Mm7|chr11 (70314690-70314958) | |
| 1-271, gnl|monDom2|scaffold_66 (3956444-3956810) | |
| 1-271, gnl|panTro1|chr19_random (44894759-44894407) | |
| 1-271, gnl|rheMac2|chr16 (6732323-6732675) | |
| 1-271, gnl|rn3|chr10 (57086171-57085821) |
| Aligned organism(s): 10 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-271, gnl|bosTau2|chr19 (14664047-14663776) | |
| 1-271, gnl|canFam2|chr5 (35043705-35044057) | |
| 1-271, gnl|hg17|chr17 (6863364-6863716) | |
| 1-271, gnl|Hg17|chr17 (6863689-6863420) | |
| 1-271, gnl|mm7|chr11 (70315016-70314665) | |
| 1-271, gnl|Mm7|chr11 (70314690-70314958) | |
| 1-271, gnl|monDom2|scaffold_66 (3956444-3956810) | |
| 1-271, gnl|panTro1|chr19_random (44894759-44894407) | |
| 1-271, gnl|rheMac2|chr16 (6732323-6732675) | |
| 1-271, gnl|rn3|chr10 (57086171-57085821) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| clu (0.358938) |