Ss1.1-Mixc-0029,a17.3
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TGATCCGGGCCTTTGGGCTGGACAGACTACCGTTGCCTGTCTCCGGTTTTCCCCGAGCAT CTAGGAAGACCCAACACCAGTGACCTCCAGCGGAGGGTGGGAGGGAGAAAACTGGACACT GCCATATGCTGCCCAGGCCTGGAGGGGCGCCCAGGGGTGGGTGGCCCTCAGGACCTGGAA TCTGAGAGGGTGGGTGGCAGAGGGGAGCTGAGCCGTCTGCACTGTTGCATAATCTGAGCC AGAGTTTGGGACCAGGCCCCCCTGCTTTTCCAGATTTAACTGTGGGCCCCAGCATGGGGT GGGGCTGGGTGACGGGGTCTGGCTCCTGGTCCCAAATCCGTTTACACATCCATCTGCTGC CTCACTGCTGTTCCGGGCTATGCCCATTGCTATGTTTACATGATTTGATGTGCAATAGGG TGGGGTGGGGGCAGGGGAGGGACTGAGCCAGGAGCAGACTTGGGAGGCAGATTGTCTCCC TTGCCTCTGGCCCAGCAGAACCTAAGCACTGTGCTATCCTGGAGGGGCTGCGGACCACCG GAGAGACGAGGGCATAGGGAGGAAGAGACCACAACCATCAGCAATAAAGTTGATCCCAGG |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TGATCCGGGCCTTTGGGCTGGACAGACTACCGTTGCCTGTCTCCGGTTTTCCCCGAGCAT CTAGGAAGACCCAACACCAGTGACCTCCAGCGGAGGGTGGGAGGGAGAAAACTGGACACT GCCATATGCTGCCCAGGCCTGGAGGGGCGCCCAGGGGTGGGTGGCCCTCAGGACCTGGAA TCTGAGAGGGTGGGTGGCAGAGGGGAGCTGAGCCGTCTGCACTGTTGCATAATCTGAGCC AGAGTTTGGGACCAGGCCCCCCTGCTTTTCCAGATTTAACTGTGGGCCCCAGCATGGGGT GGGGCTGGGTGACGGGGTCTGGCTCCTGGTCCCAAATCCGTTTACACATCCATCTGCTGC CTCACTGCTGTTCCGGGCTATGCCCATTGCTATGTTTACATGATTTGATGTGCAATAGGG TGGGGTGGGGGCAGGGGAGGGACTGAGCCAGGAGCAGACTTGGGAGGCAGATTGTCTCCC TTGCCTCTGGCCCAGCAGAACCTAAGCACTGTGCTATCCTGGAGGGGCTGCGGACCACCG GAGAGACGAGGGCATAGGGAGGAAGAGACCACAACCATCAGCAATAAAGTTGATCCCAGG |
| Predicted RNA structure(s): 2 entry(ies) | More info |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
| 94-252, - strand, RNAz p=0.997045 | |
| 406-523, + strand, RNAz p=0.993993 |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 94-252, - strand, RNAz p=0.997045 | |
| 406-523, + strand, RNAz p=0.993993 |
| Predicted microRNA(s): 2 entry(ies) | More info |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
| 418-538, + strand, RNAmicro p=0.999945 | |
| 443-496, - strand, RNAmicro p=0.998927 |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 418-538, + strand, RNAmicro p=0.999945 | |
| 443-496, - strand, RNAmicro p=0.998927 |
| Similar Transcript(s): 12 entry(ies) | More info |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
| 95-252, 67675 MARC 4BOV Bos taurus cDNA 5', mRNA sequence (gb|AW429389.1|), blast E-value=0, identity=95.57% | |
| 95-252, 67687 MARC 4BOV Bos taurus cDNA 5', mRNA sequence (gb|AW429395.1|), blast E-value=0, identity=95.57% | |
| 95-252, 705074 MARC 6BOV Bos taurus cDNA 5', mRNA sequence (gb|CB450417.1|), blast E-value=0, identity=96.84% | |
| 100-252, 705362 MARC 6BOV Bos taurus cDNA 3', mRNA sequence (gb|CB450683.1|), blast E-value=0, identity=96.73% | |
| 95-252, 4067594 BARC 10BOV Bos taurus cDNA clone 10BOV15_B03 3', mRNA (gb|CK943630.1|), blast E-value=0, identity=95.57% | |
| 95-252, BovGen_18289 normal cattle brain Bos taurus cDNA clone (gb|CO889964.1|), blast E-value=0, identity=96.84% | |
| 406-523, 705362 MARC 6BOV Bos taurus cDNA 3', mRNA sequence (gb|CB450683.1|), blast E-value=1e-35, identity=92.44% | |
| 406-523, 958003 MARC 1BOV Bos taurus cDNA 3', mRNA sequence (gb|CK769893.1|), blast E-value=2e-33, identity=91.6% | |
| 406-523, 969712 MARC 4BOV Bos taurus cDNA 3', mRNA sequence (gb|CK847119.1|), blast E-value=2e-33, identity=91.6% | |
| 406-523, 4067594 BARC 10BOV Bos taurus cDNA clone 10BOV15_B03 3', mRNA (gb|CK943630.1|), blast E-value=4e-38, identity=93.28% | |
| 406-523, BovGen_18289 normal cattle brain Bos taurus cDNA clone (gb|CO889964.1|), blast E-value=4e-38, identity=93.28% | |
| 406-523, GL-Cf-3596 GLGC-LIB0001-cf Canis familiaris Normalized Mixed Tissue (gb|DN746804.1|), blast E-value=0, identity=96.61% |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
| 95-252, 67675 MARC 4BOV Bos taurus cDNA 5', mRNA sequence (gb|AW429389.1|), blast E-value=0, identity=95.57% | |
| 95-252, 67687 MARC 4BOV Bos taurus cDNA 5', mRNA sequence (gb|AW429395.1|), blast E-value=0, identity=95.57% | |
| 95-252, 705074 MARC 6BOV Bos taurus cDNA 5', mRNA sequence (gb|CB450417.1|), blast E-value=0, identity=96.84% | |
| 100-252, 705362 MARC 6BOV Bos taurus cDNA 3', mRNA sequence (gb|CB450683.1|), blast E-value=0, identity=96.73% | |
| 95-252, 4067594 BARC 10BOV Bos taurus cDNA clone 10BOV15_B03 3', mRNA (gb|CK943630.1|), blast E-value=0, identity=95.57% | |
| 95-252, BovGen_18289 normal cattle brain Bos taurus cDNA clone (gb|CO889964.1|), blast E-value=0, identity=96.84% | |
| 406-523, 705362 MARC 6BOV Bos taurus cDNA 3', mRNA sequence (gb|CB450683.1|), blast E-value=1e-35, identity=92.44% | |
| 406-523, 958003 MARC 1BOV Bos taurus cDNA 3', mRNA sequence (gb|CK769893.1|), blast E-value=2e-33, identity=91.6% | |
| 406-523, 969712 MARC 4BOV Bos taurus cDNA 3', mRNA sequence (gb|CK847119.1|), blast E-value=2e-33, identity=91.6% | |
| 406-523, 4067594 BARC 10BOV Bos taurus cDNA clone 10BOV15_B03 3', mRNA (gb|CK943630.1|), blast E-value=4e-38, identity=93.28% | |
| 406-523, BovGen_18289 normal cattle brain Bos taurus cDNA clone (gb|CO889964.1|), blast E-value=4e-38, identity=93.28% | |
| 406-523, GL-Cf-3596 GLGC-LIB0001-cf Canis familiaris Normalized Mixed Tissue (gb|DN746804.1|), blast E-value=0, identity=96.61% |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 5' of AF260728, + |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 15-600, gnl|bosTau2|chr5 (22365733-22366315) | |
| 15-600, gnl|Hg17|chr12 (47777790-47777209) | |
| 15-600, gnl|Mm7|chr15 (98889767-98889197) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 15-600, gnl|bosTau2|chr5 (22365733-22366315) | |
| 15-600, gnl|Hg17|chr12 (47777790-47777209) | |
| 15-600, gnl|Mm7|chr15 (98889767-98889197) |
| Expressed library(ies): 3 entry(ies) | More info |
| Expressed library(ies): 3 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| fty (0.17584) | |
| fhi (0.169578) | |
| jej (0.0989218) |