Ss1.1-Pig1-97N16.5
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CTTAAATTCCTTCCCATACCTTACTAGTCAGTATATCATATCCATTCCTCTCCAGCAATC TTTCTTGAATTTGTCCCTTCCTCTCCCCTCTGCCTCTATTCTAGTTCACAGGAGCATGGG ATTTGGAGTCAGGTTATTCTGGGTTTGAATCCCAACTCTACTACTTTTTGGTTGCGTGAT AGGAGAGTTATTTAATCTCTCTGAGCCTCAGTTTCCTCATATGTAAAGTGACAATAATAA TACCTACCTCACAGGGTTGTTGTGAGGATTTAATTAGATATTGTACGAAAAGTGCCTAGC ACAGTGCCTGGCACACAGTAGAATAGGTGCTCAATAAATGGTAGCTATTGTTAAAAAAAA AAAAAAAAAAAA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CTTAAATTCCTTCCCATACCTTACTAGTCAGTATATCATATCCATTCCTCTCCAGCAATC TTTCTTGAATTTGTCCCTTCCTCTCCCCTCTGCCTCTATTCTAGTTCACAGGAGCATGGG ATTTGGAGTCAGGTTATTCTGGGTTTGAATCCCAACTCTACTACTTTTTGGTTGCGTGAT AGGAGAGTTATTTAATCTCTCTGAGCCTCAGTTTCCTCATATGTAAAGTGACAATAATAA TACCTACCTCACAGGGTTGTTGTGAGGATTTAATTAGATATTGTACGAAAAGTGCCTAGC ACAGTGCCTGGCACACAGTAGAATAGGTGCTCAATAAATGGTAGCTATTGTTAAAAAAAA AAAAAAAAAAAA |
| Predicted RNA structure(s): 2 entry(ies) | More info |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
| 37-353, - strand, RNAz p=0.997202 | |
| 69-344, - strand, RNAz p=0.999958 |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 37-353, - strand, RNAz p=0.997202 | |
| 69-344, - strand, RNAz p=0.999958 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 101-191, + strand, RNAmicro p=0.99314 |
| Similar Transcript(s): 12 entry(ies) | More info |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
| 61-349, 514835 MARC 3BOV Bos taurus cDNA 5', mRNA sequence (gb|BM253684.1|), blast E-value=0, identity=94.48% | |
| 61-349, BovGen_04447 normal cattle brain Bos taurus cDNA clone (gb|CO876122.1|), blast E-value=0, identity=94.48% | |
| 61-349, BovGen_19250 normal cattle brain Bos taurus cDNA clone (gb|CO890925.1|), blast E-value=0, identity=94.48% | |
| 61-349, 1154039 MARC 7BOV Bos taurus cDNA 3', mRNA sequence (gb|DN274980.1|), blast E-value=0, identity=94.48% | |
| 61-349, 1390320 MARC 7BOV Bos taurus cDNA 3', mRNA sequence (gb|DN541708.1|), blast E-value=0, identity=94.48% | |
| 61-349, 1391552 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN542770.1|), blast E-value=0, identity=94.48% | |
| 70-344, 514835 MARC 3BOV Bos taurus cDNA 5', mRNA sequence (gb|BM253684.1|), blast E-value=0, identity=94.93% | |
| 70-344, BovGen_04447 normal cattle brain Bos taurus cDNA clone (gb|CO876122.1|), blast E-value=0, identity=94.93% | |
| 70-344, BovGen_19250 normal cattle brain Bos taurus cDNA clone (gb|CO890925.1|), blast E-value=0, identity=94.93% | |
| 70-344, 1154039 MARC 7BOV Bos taurus cDNA 3', mRNA sequence (gb|DN274980.1|), blast E-value=0, identity=94.93% | |
| 70-344, 1390320 MARC 7BOV Bos taurus cDNA 3', mRNA sequence (gb|DN541708.1|), blast E-value=0, identity=94.93% | |
| 70-344, 1391552 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN542770.1|), blast E-value=0, identity=94.93% |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
| 61-349, 514835 MARC 3BOV Bos taurus cDNA 5', mRNA sequence (gb|BM253684.1|), blast E-value=0, identity=94.48% | |
| 61-349, BovGen_04447 normal cattle brain Bos taurus cDNA clone (gb|CO876122.1|), blast E-value=0, identity=94.48% | |
| 61-349, BovGen_19250 normal cattle brain Bos taurus cDNA clone (gb|CO890925.1|), blast E-value=0, identity=94.48% | |
| 61-349, 1154039 MARC 7BOV Bos taurus cDNA 3', mRNA sequence (gb|DN274980.1|), blast E-value=0, identity=94.48% | |
| 61-349, 1390320 MARC 7BOV Bos taurus cDNA 3', mRNA sequence (gb|DN541708.1|), blast E-value=0, identity=94.48% | |
| 61-349, 1391552 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN542770.1|), blast E-value=0, identity=94.48% | |
| 70-344, 514835 MARC 3BOV Bos taurus cDNA 5', mRNA sequence (gb|BM253684.1|), blast E-value=0, identity=94.93% | |
| 70-344, BovGen_04447 normal cattle brain Bos taurus cDNA clone (gb|CO876122.1|), blast E-value=0, identity=94.93% | |
| 70-344, BovGen_19250 normal cattle brain Bos taurus cDNA clone (gb|CO890925.1|), blast E-value=0, identity=94.93% | |
| 70-344, 1154039 MARC 7BOV Bos taurus cDNA 3', mRNA sequence (gb|DN274980.1|), blast E-value=0, identity=94.93% | |
| 70-344, 1390320 MARC 7BOV Bos taurus cDNA 3', mRNA sequence (gb|DN541708.1|), blast E-value=0, identity=94.93% | |
| 70-344, 1391552 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN542770.1|), blast E-value=0, identity=94.93% |
| Aligned organism(s): 10 entry(ies) | More info |
| Aligned organism(s): 10 entry(ies) | Help | Less info |
| 1-353, gnl|bosTau2|chr1 (51274440-51274093) | |
| 1-353, gnl|canFam2|chr34 (20076730-20077574) | |
| 1-353, gnl|hg17|chr3 (185373294-185374143) | |
| 1-353, gnl|Hg17|chr3 (185373754-185374098) | |
| 1-353, gnl|mm7|chr16 (20083377-20084087) | |
| 1-353, gnl|Mm7|chr16 (20083711-20084028) | |
| 1-353, gnl|oryCun1|scaffold_174838 (75053-75885) | |
| 1-353, gnl|panTro1|chr2 (189323743-189324591) | |
| 1-353, gnl|rheMac2|chr2 (102497458-102496605) | |
| 1-353, gnl|rn3|chr11 (82653702-82653008) |
| Aligned organism(s): 10 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-353, gnl|bosTau2|chr1 (51274440-51274093) | |
| 1-353, gnl|canFam2|chr34 (20076730-20077574) | |
| 1-353, gnl|hg17|chr3 (185373294-185374143) | |
| 1-353, gnl|Hg17|chr3 (185373754-185374098) | |
| 1-353, gnl|mm7|chr16 (20083377-20084087) | |
| 1-353, gnl|Mm7|chr16 (20083711-20084028) | |
| 1-353, gnl|oryCun1|scaffold_174838 (75053-75885) | |
| 1-353, gnl|panTro1|chr2 (189323743-189324591) | |
| 1-353, gnl|rheMac2|chr2 (102497458-102496605) | |
| 1-353, gnl|rn3|chr11 (82653702-82653008) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| fce (0.271592) |