Ss1.1-Pig1-9H20.5
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TGGCCGGAGGAGGACCCTTCGCATGGCATTAGAAGGGAGAGGGACAGCTGGGGGTCCCCC CACCCACGCCCCTCCCTCCACCTCCTGGCTGGCCCCTCAATCAGTGTTTGAGCCTCCTTG TCCCCTTACGCACCCCTTGGTGAATCCTTGGTGATGATTTTGGCAACTTCGGGAATAAAT GGCAATTGTCATGGGCATGGAGCC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TGGCCGGAGGAGGACCCTTCGCATGGCATTAGAAGGGAGAGGGACAGCTGGGGGTCCCCC CACCCACGCCCCTCCCTCCACCTCCTGGCTGGCCCCTCAATCAGTGTTTGAGCCTCCTTG TCCCCTTACGCACCCCTTGGTGAATCCTTGGTGATGATTTTGGCAACTTCGGGAATAAAT GGCAATTGTCATGGGCATGGAGCC |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 1-117, - strand, RNAz p=0.988366 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 1-117, - strand, RNAz p=0.988366 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 23-112, - strand, RNAmicro p=0.989965 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-204, gnl|bosTau2|chr18 (52552613-52552808) | |
| 1-204, gnl|Hg17|chr19 (60898736-60898947) | |
| 1-204, gnl|Mm7|chr7 (4676189-4676391) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-204, gnl|bosTau2|chr18 (52552613-52552808) | |
| 1-204, gnl|Hg17|chr19 (60898736-60898947) | |
| 1-204, gnl|Mm7|chr7 (4676189-4676391) |
| Expressed library(ies): 5 entry(ies) | More info |
| Expressed library(ies): 5 entry(ies) | Help | Less info |
| ebs (0.236602) | |
| cly (0.120642) | |
| med (0.116252) | |
| nbm (0.0993246) | |
| jej (0.0989218) |
| Expressed library(ies): 5 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| ebs (0.236602) | |
| cly (0.120642) | |
| med (0.116252) | |
| nbm (0.0993246) | |
| jej (0.0989218) |