Non-Coding RNA Search

Ss1.1-Pig2-111J04.5

Sequence:


               
               CTCCTCAATCCCACAGCCCCTGCGCTCTGCTCCTGCCCCCTGGAGTCCACGTCTGCCTCT
GTCAGCCCCGCACACGTCCCGACTTCTCTGCTCTTCACCTTCCTGATGACCCACAGGGCT
CAGGGCATCCGAGGGGCCTTGGCCCCGGCCACAGCCTCTTGGACGATGCCCTTGCTCTGT
CATGGAGGCCCCCGCTTCCCCCATCACTGGGGCCTAGGCCCAGGGGACACCATGCCTCCC
CAGGGAGGAGAGAGTCCCTTCCCTTCCAACTGGGGCTTCCACCCCCTCTCAGGGGCCGGC
GGGGAAGGGAGGAGGCAGAGAAGATGCAGATCCAATAAAAGGTATGAAACGGAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AGGGGGGGGGGGGCTTTTTTAATTTTTTTGGGGGGGGGCCCAATTTTCCCCCCCCCTTTT
TTTTTTAAAAAAGGGGGCCCTTTG

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               CTCCTCAATCCCACAGCCCCTGCGCTCTGCTCCTGCCCCCTGGAGTCCACGTCTGCCTCT
GTCAGCCCCGCACACGTCCCGACTTCTCTGCTCTTCACCTTCCTGATGACCCACAGGGCT
CAGGGCATCCGAGGGGCCTTGGCCCCGGCCACAGCCTCTTGGACGATGCCCTTGCTCTGT
CATGGAGGCCCCCGCTTCCCCCATCACTGGGGCCTAGGCCCAGGGGACACCATGCCTCCC
CAGGGAGGAGAGAGTCCCTTCCCTTCCAACTGGGGCTTCCACCCCCTCTCAGGGGCCGGC
GGGGAAGGGAGGAGGCAGAGAAGATGCAGATCCAATAAAAGGTATGAAACGGAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AGGGGGGGGGGGGCTTTTTTAATTTTTTTGGGGGGGGGCCCAATTTTCCCCCCCCCTTTT
TTTTTTAAAAAAGGGGGCCCTTTG

Predicted RNA structure(s): 1 entry(ies)

More info

Predicted RNA structure(s): 1 entry(ies)

Help | Less info


               
               77-354, - strand, RNAz p=0.999943

Predicted RNA structure(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               77-354, - strand, RNAz p=0.999943

Predicted microRNA(s): 2 entry(ies)

More info

Predicted microRNA(s): 2 entry(ies)

Help | Less info


               
               122-220, + strand, RNAmicro p=0.999992
               

               
               128-216, - strand, RNAmicro p=0.965531

Predicted microRNA(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro


               
               122-220, + strand, RNAmicro p=0.999992
               

               
               128-216, - strand, RNAmicro p=0.965531

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               81-354, BovGen_00760 normal cattle brain Bos taurus cDNA clone (gb|CO872435.1|), 
blast E-value=0, identity=88.81% 
               

               
               81-354, BovGen_12490 normal cattle brain Bos taurus cDNA clone (gb|CO884165.1|), 
blast E-value=0, identity=88.46% 
               

               
               81-354, LB00525.CR_M18 GC_BGC-05 Bos taurus cDNA clone IMAGE (gb|DT856379.1|), 
blast E-value=0, identity=88.81% 
               

               
               81-349, LB0192.CR_A19 GC_BGC-19 Bos taurus cDNA clone IMAGE (gb|DV828146.1|), 
blast E-value=0, identity=88.97% 
               

               
               81-354, LB0257.CR_A03 GC_BGC-25 Bos taurus cDNA clone IMAGE (gb|DV876896.1|), 
blast E-value=0, identity=88.81% 
               

               
               81-354, LB0259.CR_P01 GC_BGC-25 Bos taurus cDNA clone IMAGE (gb|DV877806.1|), 
blast E-value=0, identity=88.81%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               81-354, BovGen_00760 normal cattle brain Bos taurus cDNA clone (gb|CO872435.1|), 
blast E-value=0, identity=88.81% 
               

               
               81-354, BovGen_12490 normal cattle brain Bos taurus cDNA clone (gb|CO884165.1|), 
blast E-value=0, identity=88.46% 
               

               
               81-354, LB00525.CR_M18 GC_BGC-05 Bos taurus cDNA clone IMAGE (gb|DT856379.1|), 
blast E-value=0, identity=88.81% 
               

               
               81-349, LB0192.CR_A19 GC_BGC-19 Bos taurus cDNA clone IMAGE (gb|DV828146.1|), 
blast E-value=0, identity=88.97% 
               

               
               81-354, LB0257.CR_A03 GC_BGC-25 Bos taurus cDNA clone IMAGE (gb|DV876896.1|), 
blast E-value=0, identity=88.81% 
               

               
               81-354, LB0259.CR_P01 GC_BGC-25 Bos taurus cDNA clone IMAGE (gb|DV877806.1|), 
blast E-value=0, identity=88.81%

Aligned organism(s): 3 entry(ies)

More info

Aligned organism(s): 3 entry(ies)

Help | Less info


               
               3-354, gnl|bosTau2|chr29 (37219577-37219205)
               

               
               3-354, gnl|Hg17|chr11 (65820329-65820711)
               

               
               3-354, gnl|Mm7|chr19 (4975892-4975537)

Aligned organism(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               3-354, gnl|bosTau2|chr29 (37219577-37219205)
               

               
               3-354, gnl|Hg17|chr11 (65820329-65820711)
               

               
               3-354, gnl|Mm7|chr19 (4975892-4975537)

Expressed library(ies): 3 entry(ies)

More info

Expressed library(ies): 3 entry(ies)

Help | Less info


               
               fbs (0.175346)
               

               
               fhi (0.169578)
               

               
               ebs (0.118301)

Expressed library(ies): 3 entry(ies)

Help | Less info

Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description


               
               fbs (0.175346)
               

               
               fhi (0.169578)
               

               
               ebs (0.118301)

	122-220, + strand, RNAmicro p=0.999992
	128-216, - strand, RNAmicro p=0.965531

	81-354, BovGen_00760 normal cattle brain Bos taurus cDNA clone (gb\|CO872435.1\|), blast E-value=0, identity=88.81%
	81-354, BovGen_12490 normal cattle brain Bos taurus cDNA clone (gb\|CO884165.1\|), blast E-value=0, identity=88.46%
	81-354, LB00525.CR_M18 GC_BGC-05 Bos taurus cDNA clone IMAGE (gb\|DT856379.1\|), blast E-value=0, identity=88.81%
	81-349, LB0192.CR_A19 GC_BGC-19 Bos taurus cDNA clone IMAGE (gb\|DV828146.1\|), blast E-value=0, identity=88.97%
	81-354, LB0257.CR_A03 GC_BGC-25 Bos taurus cDNA clone IMAGE (gb\|DV876896.1\|), blast E-value=0, identity=88.81%
	81-354, LB0259.CR_P01 GC_BGC-25 Bos taurus cDNA clone IMAGE (gb\|DV877806.1\|), blast E-value=0, identity=88.81%

	3-354, gnl\|bosTau2\|chr29 (37219577-37219205)
	3-354, gnl\|Hg17\|chr11 (65820329-65820711)
	3-354, gnl\|Mm7\|chr19 (4975892-4975537)