Ss1.1-Pig2-43I09.5
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GCCTCCTGGCTCCCATCTGTGTTGCTGGAGATGGTGTCTGTGTGCTGGTCTTTCTGCGGG CTCTTCATGTGCAGGCTTGTTCGGGGTTGCCTGGCAACTGTTCTGGCACCAGGTGTGCCA GCACCATGGGTGGAAGCAGACTGAGAATTAGTTTAATCACAGGTGTGCGTGCACACATGT GTCTCACATCACCACGTCGGCAGGAGGAGCCTGCCGGGCCTTGAGTCACTAGGCTCTGCT GCTGAGAAGTGAGAGAAGTCACTGGGGCTCAGCCGGGCCTTGGAGCCCTGTATAGAACTC TCGGTTGCTAGGGCAACCATGAGCCTGTTGCTAGGAGATAGCTGGGGAAGGCCCAAGGCT GTCCAGGGCAGAGAGATGAACAGAGGAGTTTGAGAGAGTGGGGGAGGCTATGGAAAAGGA TGGGATTTCTGGGTCCCTGGGGGATGGGATACTCACAAACGACTTCTTCACTGGGGGAGT CGCTTGCTATTTATCACTGGTCACGATTTACAAGAAGACAAATAAAATTGCTTTTAGAAC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GCCTCCTGGCTCCCATCTGTGTTGCTGGAGATGGTGTCTGTGTGCTGGTCTTTCTGCGGG CTCTTCATGTGCAGGCTTGTTCGGGGTTGCCTGGCAACTGTTCTGGCACCAGGTGTGCCA GCACCATGGGTGGAAGCAGACTGAGAATTAGTTTAATCACAGGTGTGCGTGCACACATGT GTCTCACATCACCACGTCGGCAGGAGGAGCCTGCCGGGCCTTGAGTCACTAGGCTCTGCT GCTGAGAAGTGAGAGAAGTCACTGGGGCTCAGCCGGGCCTTGGAGCCCTGTATAGAACTC TCGGTTGCTAGGGCAACCATGAGCCTGTTGCTAGGAGATAGCTGGGGAAGGCCCAAGGCT GTCCAGGGCAGAGAGATGAACAGAGGAGTTTGAGAGAGTGGGGGAGGCTATGGAAAAGGA TGGGATTTCTGGGTCCCTGGGGGATGGGATACTCACAAACGACTTCTTCACTGGGGGAGT CGCTTGCTATTTATCACTGGTCACGATTTACAAGAAGACAAATAAAATTGCTTTTAGAAC |
| Predicted RNA structure(s): 2 entry(ies) | More info |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
| 162-385, - strand, RNAz p=0.995596 | |
| 203-392, - strand, RNAz p=0.999817 |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 162-385, - strand, RNAz p=0.995596 | |
| 203-392, - strand, RNAz p=0.999817 |
| Similar Transcript(s): 12 entry(ies) | More info |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
| 225-361, 457322 MARC 1BOV Bos taurus cDNA 5', mRNA sequence (gb|BI680004.1|), blast E-value=8e-32, identity=88.32% | |
| 192-361, 1Duo10C05 Bos taurus Duodenum #1 library Bos taurus cDNA, mRNA (gb|BM431138.1|), blast E-value=1e-39, identity=87.65% | |
| 192-361, 4014537 BARC-EMBRAPA 356BOV Bos indicus cDNA clone 356BOV_1J23 (gb|CB061456.1|), blast E-value=2e-35, identity=86.47% | |
| 192-361, 959364 MARC 1BOV Bos taurus cDNA 3', mRNA sequence (gb|CK771125.1|), blast E-value=1e-39, identity=87.65% | |
| 192-361, BovGen_02303 normal cattle brain Bos taurus cDNA clone (gb|CO873978.1|), blast E-value=1e-39, identity=87.65% | |
| 192-361, LB0294.CR.1_A23 GC_BGC-29 Bos taurus cDNA clone IMAGE (gb|DV917172.1|), blast E-value=1e-39, identity=87.65% | |
| 225-361, 457322 MARC 1BOV Bos taurus cDNA 5', mRNA sequence (gb|BI680004.1|), blast E-value=7e-32, identity=88.32% | |
| 203-392, 1Duo10C05 Bos taurus Duodenum #1 library Bos taurus cDNA, mRNA (gb|BM431138.1|), blast E-value=3e-37, identity=86.53% | |
| 203-361, 4014537 BARC-EMBRAPA 356BOV Bos indicus cDNA clone 356BOV_1J23 (gb|CB061456.1|), blast E-value=4e-33, identity=86.79% | |
| 203-361, 959364 MARC 1BOV Bos taurus cDNA 3', mRNA sequence (gb|CK771125.1|), blast E-value=2e-35, identity=87.42% | |
| 203-361, BovGen_02303 normal cattle brain Bos taurus cDNA clone (gb|CO873978.1|), blast E-value=2e-35, identity=87.42% | |
| 203-392, LB0294.CR.1_A23 GC_BGC-29 Bos taurus cDNA clone IMAGE (gb|DV917172.1|), blast E-value=3e-37, identity=86.53% |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
| 225-361, 457322 MARC 1BOV Bos taurus cDNA 5', mRNA sequence (gb|BI680004.1|), blast E-value=8e-32, identity=88.32% | |
| 192-361, 1Duo10C05 Bos taurus Duodenum #1 library Bos taurus cDNA, mRNA (gb|BM431138.1|), blast E-value=1e-39, identity=87.65% | |
| 192-361, 4014537 BARC-EMBRAPA 356BOV Bos indicus cDNA clone 356BOV_1J23 (gb|CB061456.1|), blast E-value=2e-35, identity=86.47% | |
| 192-361, 959364 MARC 1BOV Bos taurus cDNA 3', mRNA sequence (gb|CK771125.1|), blast E-value=1e-39, identity=87.65% | |
| 192-361, BovGen_02303 normal cattle brain Bos taurus cDNA clone (gb|CO873978.1|), blast E-value=1e-39, identity=87.65% | |
| 192-361, LB0294.CR.1_A23 GC_BGC-29 Bos taurus cDNA clone IMAGE (gb|DV917172.1|), blast E-value=1e-39, identity=87.65% | |
| 225-361, 457322 MARC 1BOV Bos taurus cDNA 5', mRNA sequence (gb|BI680004.1|), blast E-value=7e-32, identity=88.32% | |
| 203-392, 1Duo10C05 Bos taurus Duodenum #1 library Bos taurus cDNA, mRNA (gb|BM431138.1|), blast E-value=3e-37, identity=86.53% | |
| 203-361, 4014537 BARC-EMBRAPA 356BOV Bos indicus cDNA clone 356BOV_1J23 (gb|CB061456.1|), blast E-value=4e-33, identity=86.79% | |
| 203-361, 959364 MARC 1BOV Bos taurus cDNA 3', mRNA sequence (gb|CK771125.1|), blast E-value=2e-35, identity=87.42% | |
| 203-361, BovGen_02303 normal cattle brain Bos taurus cDNA clone (gb|CO873978.1|), blast E-value=2e-35, identity=87.42% | |
| 203-392, LB0294.CR.1_A23 GC_BGC-29 Bos taurus cDNA clone IMAGE (gb|DV917172.1|), blast E-value=3e-37, identity=86.53% |
| Aligned organism(s): 12 entry(ies) | More info |
| Aligned organism(s): 12 entry(ies) | Help | Less info |
| 1-539, gnl|bosTau2|chr19 (20874237-20873696) | |
| 1-539, gnl|canFam2|chr5 (35304605-35305222) | |
| 1-539, gnl|dasNov1|scaffold_93483 (7561-8165) | |
| 1-539, gnl|echTel1|scaffold_320465 (36960-37572) | |
| 1-539, gnl|hg17|chr17 (7198339-7198972) | |
| 1-539, gnl|Hg17|chr17 (7198422-7198980) | |
| 1-539, gnl|mm7|chr11 (69960475-69959851) | |
| 1-539, gnl|Mm7|chr11 (69960404-69959841) | |
| 1-539, gnl|monDom2|scaffold_66 (4297497-4298129) | |
| 1-539, gnl|panTro1|chr19_random (44551041-44550407) | |
| 1-539, gnl|rheMac2|chr16 (7090537-7091153) | |
| 1-539, gnl|rn3|chr10 (56736478-56735799) |
| Aligned organism(s): 12 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-539, gnl|bosTau2|chr19 (20874237-20873696) | |
| 1-539, gnl|canFam2|chr5 (35304605-35305222) | |
| 1-539, gnl|dasNov1|scaffold_93483 (7561-8165) | |
| 1-539, gnl|echTel1|scaffold_320465 (36960-37572) | |
| 1-539, gnl|hg17|chr17 (7198339-7198972) | |
| 1-539, gnl|Hg17|chr17 (7198422-7198980) | |
| 1-539, gnl|mm7|chr11 (69960475-69959851) | |
| 1-539, gnl|Mm7|chr11 (69960404-69959841) | |
| 1-539, gnl|monDom2|scaffold_66 (4297497-4298129) | |
| 1-539, gnl|panTro1|chr19_random (44551041-44550407) | |
| 1-539, gnl|rheMac2|chr16 (7090537-7091153) | |
| 1-539, gnl|rn3|chr10 (56736478-56735799) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| hyp (0.142837) |