Ss1.1-rcad15b_a3.5
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAGAATCCAG CTTTGACCTTTATTCAAGAGACCAGATGGGTTGCCCCAGGATCCGGCTGCCAGCCCTGAG GCCAAGCAAGGCTGGAGACCCACAATCTGGCCCTGCTTTGCCCTGAGCTGCAGCCTCAGC CCCAGGATCCTGCCTGCAGCCACTGAGGGGCGGGCGGAGGGAGCCCTGGGGGGTTGGGAG CTGCTATTGATTCATAAAAAAAAAAAAAAAAAAAAA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAGAATCCAG CTTTGACCTTTATTCAAGAGACCAGATGGGTTGCCCCAGGATCCGGCTGCCAGCCCTGAG GCCAAGCAAGGCTGGAGACCCACAATCTGGCCCTGCTTTGCCCTGAGCTGCAGCCTCAGC CCCAGGATCCTGCCTGCAGCCACTGAGGGGCGGGCGGAGGGAGCCCTGGGGGGTTGGGAG CTGCTATTGATTCATAAAAAAAAAAAAAAAAAAAAA |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 52-271, - strand, RNAz p=0.994786 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 52-271, - strand, RNAz p=0.994786 |
| Predicted microRNA(s): 2 entry(ies) | More info |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
| 107-261, - strand, RNAmicro p=0.999857 | |
| 97-255, + strand, RNAmicro p=0.999833 |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 107-261, - strand, RNAmicro p=0.999857 | |
| 97-255, + strand, RNAmicro p=0.999833 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 5' of CR595463, - |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 52-271, gnl|bosTau2|chr29 (39768879-39768659) | |
| 52-271, gnl|Hg17|chr11 (66922231-66922455) | |
| 52-271, gnl|Mm7|chr19 (4090224-4090011) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 52-271, gnl|bosTau2|chr29 (39768879-39768659) | |
| 52-271, gnl|Hg17|chr11 (66922231-66922455) | |
| 52-271, gnl|Mm7|chr19 (4090224-4090011) |
| Expressed library(ies): 10 entry(ies) | More info |
| Expressed library(ies): 10 entry(ies) | Help | Less info |
| cag (0.453583) | |
| amn (0.417711) | |
| fce (0.271592) | |
| nms (0.213858) | |
| jej (0.197844) | |
| fty (0.17584) | |
| nmm (0.132802) | |
| cly (0.120642) | |
| med (0.116252) | |
| nbm (0.0993246) |
| Expressed library(ies): 10 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| cag (0.453583) | |
| amn (0.417711) | |
| fce (0.271592) | |
| nms (0.213858) | |
| jej (0.197844) | |
| fty (0.17584) | |
| nmm (0.132802) | |
| cly (0.120642) | |
| med (0.116252) | |
| nbm (0.0993246) |