Non-Coding RNA Search

Ss1.1-rcbe01_a12.5

Sequence:


               
               TGGAAACCAGTCATTCTAAGGAATCATAAACCTTGCCTGGACATTGGCCACCTAAAAGAT
CAGTGTGGTGCTGCGTTCTGGCCAGTAAAGTCCATATTTTTGGCTATCTCTCATCCCAAC
GGAGCGGTTTCTGTGTATATATAGAAGGTAGAAACGGAAAGCGAGAAAACTATTTGAAAG
GGATTATATTAATTGCTAAATATTTTATTCACAAAGGTCAGTAACATGGCAAGATAAAAT
TATTTGTATAGTTTTGTCTGAATGAGCGAGAAAAATGTGGATTATTGTTTGTATATATTG
TATATATTAAAACAAAAGAGATACGTGCATGAACTCAAGAACAAAGAAATGAACAAAAGC
AAAGCATTAGTGGCTATGGTCTGTAAAATGAAACAAAAAAAACTTTATTTCACTATAAGA
GTACTTTATTTTAAATGTTCTTTAGAAGAACATTTTGCTAAAGCATGACTAAACTGCAAA

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               TGGAAACCAGTCATTCTAAGGAATCATAAACCTTGCCTGGACATTGGCCACCTAAAAGAT
CAGTGTGGTGCTGCGTTCTGGCCAGTAAAGTCCATATTTTTGGCTATCTCTCATCCCAAC
GGAGCGGTTTCTGTGTATATATAGAAGGTAGAAACGGAAAGCGAGAAAACTATTTGAAAG
GGATTATATTAATTGCTAAATATTTTATTCACAAAGGTCAGTAACATGGCAAGATAAAAT
TATTTGTATAGTTTTGTCTGAATGAGCGAGAAAAATGTGGATTATTGTTTGTATATATTG
TATATATTAAAACAAAAGAGATACGTGCATGAACTCAAGAACAAAGAAATGAACAAAAGC
AAAGCATTAGTGGCTATGGTCTGTAAAATGAAACAAAAAAAACTTTATTTCACTATAAGA
GTACTTTATTTTAAATGTTCTTTAGAAGAACATTTTGCTAAAGCATGACTAAACTGCAAA

Predicted RNA structure(s): 2 entry(ies)

More info

Predicted RNA structure(s): 2 entry(ies)

Help | Less info


               
               158-271, + strand, RNAz p=0.808761
               

               
               349-480, - strand, RNAz p=0.989076

Predicted RNA structure(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               158-271, + strand, RNAz p=0.808761
               

               
               349-480, - strand, RNAz p=0.989076

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               349-480, CJ433205 macaque brain cDNA library QccE Macaca fascicularis cDNA 
(dbj|CJ433205.1|), blast E-value=0, identity=93.94% 
               

               
               349-480, DB573138 RIKEN full-length enriched human cDNA library, 
(dbj|DB573138.1|), blast E-value=0, identity=93.18% 
               

               
               349-480, DB577206 RIKEN full-length enriched human cDNA library, 
(dbj|DB577206.1|), blast E-value=0, identity=93.18% 
               

               
               349-480, DG2-139d11 DG2-brain Canis familiaris cDNA 3', mRNA sequence 
(gb|CO586948.1|), blast E-value=0, identity=93.94% 
               

               
               349-480, DG2-52d13 DG2-brain Canis familiaris cDNA 3', mRNA sequence 
(gb|CO591626.1|), blast E-value=0, identity=93.94% 
               

               
               349-480, ILLUMIGEN_MCQ_10178 Katze_MMPL2 Macaca mulatta cDNA clone 
(gb|CO645295.1|), blast E-value=0, identity=93.94%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               349-480, CJ433205 macaque brain cDNA library QccE Macaca fascicularis cDNA 
(dbj|CJ433205.1|), blast E-value=0, identity=93.94% 
               

               
               349-480, DB573138 RIKEN full-length enriched human cDNA library, 
(dbj|DB573138.1|), blast E-value=0, identity=93.18% 
               

               
               349-480, DB577206 RIKEN full-length enriched human cDNA library, 
(dbj|DB577206.1|), blast E-value=0, identity=93.18% 
               

               
               349-480, DG2-139d11 DG2-brain Canis familiaris cDNA 3', mRNA sequence 
(gb|CO586948.1|), blast E-value=0, identity=93.94% 
               

               
               349-480, DG2-52d13 DG2-brain Canis familiaris cDNA 3', mRNA sequence 
(gb|CO591626.1|), blast E-value=0, identity=93.94% 
               

               
               349-480, ILLUMIGEN_MCQ_10178 Katze_MMPL2 Macaca mulatta cDNA clone 
(gb|CO645295.1|), blast E-value=0, identity=93.94%

Homologous human UTR: 1 entry(ies)

More info

Homologous human UTR: 1 entry(ies)

Help | Less info


               
               3' of AF111804, +

Homologous human UTR: 1 entry(ies)

Help | Less info

Human gene identifier and UTR site,
human gene reading direction


               
               3' of AF111804, +

Aligned organism(s): 3 entry(ies)

More info

Aligned organism(s): 3 entry(ies)

Help | Less info


               
               1-480, gnl|bosTau2|chr16 (29856093-29856571)
               

               
               1-480, gnl|Hg17|chr1 (7761695-7762170)
               

               
               1-480, gnl|Mm7|chr4 (150051446-150050979)

Aligned organism(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               1-480, gnl|bosTau2|chr16 (29856093-29856571)
               

               
               1-480, gnl|Hg17|chr1 (7761695-7762170)
               

               
               1-480, gnl|Mm7|chr4 (150051446-150050979)

Expressed library(ies): 4 entry(ies)

More info

Expressed library(ies): 4 entry(ies)

Help | Less info


               
               fco (0.314416)
               

               
               cbe (0.239234)
               

               
               ebs (0.118301)
               

               
               spc (0.113366)

Expressed library(ies): 4 entry(ies)

Help | Less info

Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description


               
               fco (0.314416)
               

               
               cbe (0.239234)
               

               
               ebs (0.118301)
               

               
               spc (0.113366)

	158-271, + strand, RNAz p=0.808761
	349-480, - strand, RNAz p=0.989076

	349-480, CJ433205 macaque brain cDNA library QccE Macaca fascicularis cDNA (dbj\|CJ433205.1\|), blast E-value=0, identity=93.94%
	349-480, DB573138 RIKEN full-length enriched human cDNA library, (dbj\|DB573138.1\|), blast E-value=0, identity=93.18%
	349-480, DB577206 RIKEN full-length enriched human cDNA library, (dbj\|DB577206.1\|), blast E-value=0, identity=93.18%
	349-480, DG2-139d11 DG2-brain Canis familiaris cDNA 3', mRNA sequence (gb\|CO586948.1\|), blast E-value=0, identity=93.94%
	349-480, DG2-52d13 DG2-brain Canis familiaris cDNA 3', mRNA sequence (gb\|CO591626.1\|), blast E-value=0, identity=93.94%
	349-480, ILLUMIGEN_MCQ_10178 Katze_MMPL2 Macaca mulatta cDNA clone (gb\|CO645295.1\|), blast E-value=0, identity=93.94%

	1-480, gnl\|bosTau2\|chr16 (29856093-29856571)
	1-480, gnl\|Hg17\|chr1 (7761695-7762170)
	1-480, gnl\|Mm7\|chr4 (150051446-150050979)