Non-Coding RNA Search

Ss1.1-rcbe15_h15.5

Sequence:


               
               ATCAAATTTAGAAATATCTCTATATGTGAGACTAGGAATTTATGTAATCTGTGAGTAACG
GAAATAAGGGTATCCTTTCTTGTTTCTAATGATTGTTATGTTTTTCTTAGGTTTGAGAAC
AACTATGTATTAGCTTTACTTGGCTGATGTCGGTAAATGTGTCTATTTCCTAAATGTAAG
GACTGCACTTAATAATTTATGTAAACGTGAAACACTACAGTAGCAGAAAAAAATAACATC
GGCACTTTAGCCAAAATATGCACTGTAACATGGATGTATTTCTACTACTGCCAAATAAAA
AAGCAATGGTAAAAAAAAAAAAAAAAAAAAAAAAAA

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               ATCAAATTTAGAAATATCTCTATATGTGAGACTAGGAATTTATGTAATCTGTGAGTAACG
GAAATAAGGGTATCCTTTCTTGTTTCTAATGATTGTTATGTTTTTCTTAGGTTTGAGAAC
AACTATGTATTAGCTTTACTTGGCTGATGTCGGTAAATGTGTCTATTTCCTAAATGTAAG
GACTGCACTTAATAATTTATGTAAACGTGAAACACTACAGTAGCAGAAAAAAATAACATC
GGCACTTTAGCCAAAATATGCACTGTAACATGGATGTATTTCTACTACTGCCAAATAAAA
AAGCAATGGTAAAAAAAAAAAAAAAAAAAAAAAAAA

Predicted RNA structure(s): 1 entry(ies)

More info

Predicted RNA structure(s): 1 entry(ies)

Help | Less info


               
               142-320, - strand, RNAz p=0.997137

Predicted RNA structure(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               142-320, - strand, RNAz p=0.997137

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               245-226, DB295722 ASTRO2 Homo sapiens cDNA clone ASTRO2011492 3', mRNA 
(dbj|DB295722.1|), blast E-value=0.00000000000001, identity=88.1% 
               

               
               245-226, UI-1-BB1p-atr-f-02-0-UI.s1 NCI_CGAP_Pl6 Homo sapiens cDNA clone 
(gb|BQ024742.1|), blast E-value=0.00000000000001, identity=88.1% 
               

               
               245-225, UI-1-BB1-aic-h-02-0-UI.s1 NCI_CGAP_Pl5 Homo sapiens cDNA clone 
(gb|BU752927.1|), blast E-value=0.00000000000005, identity=87.95% 
               

               
               245-226, UI-H-DT0-aue-l-20-0-UI.s1 NCI_CGAP_DT0 Homo sapiens cDNA clone 
(gb|CA436207.1|), blast E-value=0.00000000000001, identity=88.1% 
               

               
               245-303, nbc13h09.x1 Rabbit trigeminal nerve. Unnormalized (nbc) Oryctolagus 
(gb|EB374505.1|), blast E-value=2e-16, identity=94.92% 
               

               
               245-303, nbc13h09.y1 Rabbit trigeminal nerve. Unnormalized (nbc) Oryctolagus 
(gb|EB374506.1|), blast E-value=2e-16, identity=94.92%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               245-226, DB295722 ASTRO2 Homo sapiens cDNA clone ASTRO2011492 3', mRNA 
(dbj|DB295722.1|), blast E-value=0.00000000000001, identity=88.1% 
               

               
               245-226, UI-1-BB1p-atr-f-02-0-UI.s1 NCI_CGAP_Pl6 Homo sapiens cDNA clone 
(gb|BQ024742.1|), blast E-value=0.00000000000001, identity=88.1% 
               

               
               245-225, UI-1-BB1-aic-h-02-0-UI.s1 NCI_CGAP_Pl5 Homo sapiens cDNA clone 
(gb|BU752927.1|), blast E-value=0.00000000000005, identity=87.95% 
               

               
               245-226, UI-H-DT0-aue-l-20-0-UI.s1 NCI_CGAP_DT0 Homo sapiens cDNA clone 
(gb|CA436207.1|), blast E-value=0.00000000000001, identity=88.1% 
               

               
               245-303, nbc13h09.x1 Rabbit trigeminal nerve. Unnormalized (nbc) Oryctolagus 
(gb|EB374505.1|), blast E-value=2e-16, identity=94.92% 
               

               
               245-303, nbc13h09.y1 Rabbit trigeminal nerve. Unnormalized (nbc) Oryctolagus 
(gb|EB374506.1|), blast E-value=2e-16, identity=94.92%

Aligned organism(s): 2 entry(ies)

More info

Aligned organism(s): 2 entry(ies)

Help | Less info


               
               1-320, gnl|bosTau2|chr2 (66900183-66899845)
               

               
               1-320, gnl|Hg17|chr1 (78056935-78057245)

Aligned organism(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               1-320, gnl|bosTau2|chr2 (66900183-66899845)
               

               
               1-320, gnl|Hg17|chr1 (78056935-78057245)

Expressed library(ies): 2 entry(ies)

More info

Expressed library(ies): 2 entry(ies)

Help | Less info


               
               cbe (0.239234)
               

               
               hyp (0.142837)

Expressed library(ies): 2 entry(ies)

Help | Less info

Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description


               
               cbe (0.239234)
               

               
               hyp (0.142837)

	245-226, DB295722 ASTRO2 Homo sapiens cDNA clone ASTRO2011492 3', mRNA (dbj\|DB295722.1\|), blast E-value=0.00000000000001, identity=88.1%
	245-226, UI-1-BB1p-atr-f-02-0-UI.s1 NCI_CGAP_Pl6 Homo sapiens cDNA clone (gb\|BQ024742.1\|), blast E-value=0.00000000000001, identity=88.1%
	245-225, UI-1-BB1-aic-h-02-0-UI.s1 NCI_CGAP_Pl5 Homo sapiens cDNA clone (gb\|BU752927.1\|), blast E-value=0.00000000000005, identity=87.95%
	245-226, UI-H-DT0-aue-l-20-0-UI.s1 NCI_CGAP_DT0 Homo sapiens cDNA clone (gb\|CA436207.1\|), blast E-value=0.00000000000001, identity=88.1%
	245-303, nbc13h09.x1 Rabbit trigeminal nerve. Unnormalized (nbc) Oryctolagus (gb\|EB374505.1\|), blast E-value=2e-16, identity=94.92%
	245-303, nbc13h09.y1 Rabbit trigeminal nerve. Unnormalized (nbc) Oryctolagus (gb\|EB374506.1\|), blast E-value=2e-16, identity=94.92%

	1-320, gnl\|bosTau2\|chr2 (66900183-66899845)
	1-320, gnl\|Hg17\|chr1 (78056935-78057245)