Non-Coding RNA Search

Ss1.1-rcst21_a6.5

Sequence:


               
               GGGGCGCCTGCGTCCCTGCTCCTCTGTCCTAGCACAGTGCACCCGGGCTCCCGCGCAGGA
AAGGCCCCAGAGCTGCGGCCTGGGACCTGGACACTGGCCCCCTCCCCCTTCCCTCCCCAC
CTCCCCAGCCAGCTGGAGAGCCTGGTCTCTGGAGCTGCCGCAGGAAGGAGAAAGAGGGCA
GAAAGGAAGAGGGGTGGAGGTGGCGGGAAGTCCAGGACCTGCTCCTCGTGGGCACCTCAC
TGGCCCCCTGGAGCCTGCCGGGTGGGGGGCCGCAGGCGGACAGCCGAGGTGGGGGCCCGT
GTTTTACGTGCGCCCTCGCCTCGCCCGGGCCGGCCCCTCCCCAGTGCACACTCACCTCGG
CGGCCTTTATTTATTCTGTTCCCCTCGCTCAGCCACTTCCAGGGGAGGGCTGGGTGCTGG
GCCTGTACCGAATAAACGCAAACCCAGATGGAAAAAAAAAAAAAAAAA

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               GGGGCGCCTGCGTCCCTGCTCCTCTGTCCTAGCACAGTGCACCCGGGCTCCCGCGCAGGA
AAGGCCCCAGAGCTGCGGCCTGGGACCTGGACACTGGCCCCCTCCCCCTTCCCTCCCCAC
CTCCCCAGCCAGCTGGAGAGCCTGGTCTCTGGAGCTGCCGCAGGAAGGAGAAAGAGGGCA
GAAAGGAAGAGGGGTGGAGGTGGCGGGAAGTCCAGGACCTGCTCCTCGTGGGCACCTCAC
TGGCCCCCTGGAGCCTGCCGGGTGGGGGGCCGCAGGCGGACAGCCGAGGTGGGGGCCCGT
GTTTTACGTGCGCCCTCGCCTCGCCCGGGCCGGCCCCTCCCCAGTGCACACTCACCTCGG
CGGCCTTTATTTATTCTGTTCCCCTCGCTCAGCCACTTCCAGGGGAGGGCTGGGTGCTGG
GCCTGTACCGAATAAACGCAAACCCAGATGGAAAAAAAAAAAAAAAAA

Predicted RNA structure(s): 2 entry(ies)

More info

Predicted RNA structure(s): 2 entry(ies)

Help | Less info


               
               1-220, - strand, RNAz p=0.99945
               

               
               333-452, + strand, RNAz p=0.962454

Predicted RNA structure(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               1-220, - strand, RNAz p=0.99945
               

               
               333-452, + strand, RNAz p=0.962454

Predicted microRNA(s): 2 entry(ies)

More info

Predicted microRNA(s): 2 entry(ies)

Help | Less info


               
               96-235, - strand, RNAmicro p=0.999998
               

               
               384-477, + strand, RNAmicro p=0.975254

Predicted microRNA(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro


               
               96-235, - strand, RNAmicro p=0.999998
               

               
               384-477, + strand, RNAmicro p=0.975254

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               1-97, DB332008 SMINT2 Homo sapiens cDNA clone SMINT2008960 3', mRNA 
(dbj|DB332008.1|), blast E-value=0.000000000001, identity=85.57% 
               

               
               1-97, DB552055 RIKEN full-length enriched human cDNA library, (dbj|DB552055.1|), 
blast E-value=0.000000000001, identity=85.57% 
               

               
               1-97, DB569653 RIKEN full-length enriched human cDNA library, (dbj|DB569653.1|), 
blast E-value=0.000000000001, identity=85.57% 
               

               
               127-220, DB807882 full-length enriched swine cDNA library, adult liver Sus 
(dbj|DB807882.1|), blast E-value=1.96182e-44, identity=100% 
               

               
               127-220, DB819195 full-length enriched swine cDNA library, adult thymus Sus 
(dbj|DB819195.1|), blast E-value=8e-35, identity=95.74% 
               

               
               127-220, PADT0811017_H09F porcine adipose tissue cDNA library (PADT) Sus 
(gb|EB418177.1|), blast E-value=3e-40, identity=97.87%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               1-97, DB332008 SMINT2 Homo sapiens cDNA clone SMINT2008960 3', mRNA 
(dbj|DB332008.1|), blast E-value=0.000000000001, identity=85.57% 
               

               
               1-97, DB552055 RIKEN full-length enriched human cDNA library, (dbj|DB552055.1|), 
blast E-value=0.000000000001, identity=85.57% 
               

               
               1-97, DB569653 RIKEN full-length enriched human cDNA library, (dbj|DB569653.1|), 
blast E-value=0.000000000001, identity=85.57% 
               

               
               127-220, DB807882 full-length enriched swine cDNA library, adult liver Sus 
(dbj|DB807882.1|), blast E-value=1.96182e-44, identity=100% 
               

               
               127-220, DB819195 full-length enriched swine cDNA library, adult thymus Sus 
(dbj|DB819195.1|), blast E-value=8e-35, identity=95.74% 
               

               
               127-220, PADT0811017_H09F porcine adipose tissue cDNA library (PADT) Sus 
(gb|EB418177.1|), blast E-value=3e-40, identity=97.87%

Homologous human UTR: 1 entry(ies)

More info

Homologous human UTR: 1 entry(ies)

Help | Less info


               
               3' of NM_012407, +

Homologous human UTR: 1 entry(ies)

Help | Less info

Human gene identifier and UTR site,
human gene reading direction


               
               3' of NM_012407, +

Aligned organism(s): 2 entry(ies)

More info

Aligned organism(s): 2 entry(ies)

Help | Less info


               
               1-452, gnl|bosTau2|chr5 (66923590-66923124)
               

               
               1-452, gnl|Hg17|chr22 (36795746-36796205)

Aligned organism(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               1-452, gnl|bosTau2|chr5 (66923590-66923124)
               

               
               1-452, gnl|Hg17|chr22 (36795746-36796205)

Expressed library(ies): 3 entry(ies)

More info

Expressed library(ies): 3 entry(ies)

Help | Less info


               
               cst (0.280073)
               

               
               nmm (0.132802)
               

               
               cly (0.120642)

Expressed library(ies): 3 entry(ies)

Help | Less info

Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description


               
               cst (0.280073)
               

               
               nmm (0.132802)
               

               
               cly (0.120642)

	1-220, - strand, RNAz p=0.99945
	333-452, + strand, RNAz p=0.962454

	96-235, - strand, RNAmicro p=0.999998
	384-477, + strand, RNAmicro p=0.975254

	1-97, DB332008 SMINT2 Homo sapiens cDNA clone SMINT2008960 3', mRNA (dbj\|DB332008.1\|), blast E-value=0.000000000001, identity=85.57%
	1-97, DB552055 RIKEN full-length enriched human cDNA library, (dbj\|DB552055.1\|), blast E-value=0.000000000001, identity=85.57%
	1-97, DB569653 RIKEN full-length enriched human cDNA library, (dbj\|DB569653.1\|), blast E-value=0.000000000001, identity=85.57%
	127-220, DB807882 full-length enriched swine cDNA library, adult liver Sus (dbj\|DB807882.1\|), blast E-value=1.96182e-44, identity=100%
	127-220, DB819195 full-length enriched swine cDNA library, adult thymus Sus (dbj\|DB819195.1\|), blast E-value=8e-35, identity=95.74%
	127-220, PADT0811017_H09F porcine adipose tissue cDNA library (PADT) Sus (gb\|EB418177.1\|), blast E-value=3e-40, identity=97.87%

	1-452, gnl\|bosTau2\|chr5 (66923590-66923124)
	1-452, gnl\|Hg17\|chr22 (36795746-36796205)