Ss1.1-rese11c_p12.5
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GGGGTGGCCCTTCCCCGTCCCTCTAAAGCAATAATGGTTCCCATCCAGGCAGCAGGGAGG CTGGCCTAGTGGGTATTTGAAGGAGGAGGCCACCTCTCCAAGGGCTTTTGCATCCGCTAC CCCGCCCCCCACCTCTGGTGAGCCTCGGGTGGAAGCAGTGAGCAAAGGAAGGGACCAAGG CCAGGCAGGCACCTCCGGGGCGCGCACGTGGGTCCACGCGCGTTTGTCCCTTTGCCCCCG TCTACTGCGCTGGCTGCCTGCCAAGCAAGGTTGGCCCAGCCCCACGCTGGTGCCCCTACC ACCCTCCCCTCTCCAGCACCCTTCCCTCCCGCCAGGGCCCAAGTCCCTGTTTTCTGAGCC CGGGGCCACCTGGGCTGTTGGCACTCGCAGTCCCAGAGCCCCTGGGTGGGTGGTGGGGAG |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GGGGTGGCCCTTCCCCGTCCCTCTAAAGCAATAATGGTTCCCATCCAGGCAGCAGGGAGG CTGGCCTAGTGGGTATTTGAAGGAGGAGGCCACCTCTCCAAGGGCTTTTGCATCCGCTAC CCCGCCCCCCACCTCTGGTGAGCCTCGGGTGGAAGCAGTGAGCAAAGGAAGGGACCAAGG CCAGGCAGGCACCTCCGGGGCGCGCACGTGGGTCCACGCGCGTTTGTCCCTTTGCCCCCG TCTACTGCGCTGGCTGCCTGCCAAGCAAGGTTGGCCCAGCCCCACGCTGGTGCCCCTACC ACCCTCCCCTCTCCAGCACCCTTCCCTCCCGCCAGGGCCCAAGTCCCTGTTTTCTGAGCC CGGGGCCACCTGGGCTGTTGGCACTCGCAGTCCCAGAGCCCCTGGGTGGGTGGTGGGGAG |
| Predicted RNA structure(s): 2 entry(ies) | More info |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
| 284-420, - strand, RNAz p=0.999048 | |
| 285-420, - strand, RNAz p=0.996977 |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 284-420, - strand, RNAz p=0.999048 | |
| 285-420, - strand, RNAz p=0.996977 |
| Similar Transcript(s): 12 entry(ies) | More info |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
| 298-420, AL577988 Homo sapiens HELA CELLS COT 25-NORMALIZED Homo sapiens (emb|AL577988.3|), blast E-value=2e-28, identity=89.43% | |
| 298-420, BX365643 Homo sapiens HELA CELLS COT 25-NORMALIZED Homo sapiens (emb|BX365643.2|), blast E-value=2e-28, identity=89.43% | |
| 298-420, AGENCOURT_15342796 Lupski_anterior_horn Homo sapiens cDNA clone (gb|CF454722.1|), blast E-value=2e-28, identity=89.43% | |
| 298-420, if25c01.y5 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens (gb|CK819816.1|), blast E-value=2e-28, identity=89.43% | |
| 319-415, LIB5338-011-A1-K1-G4 LIB5338 Canis familiaris cDNA clone (gb|DN444560.1|), blast E-value=2e-34, identity=94.85% | |
| 298-381, sh3P0035K18_F.ab1 adult sheep fracture callus 10d Ovis aries cDNA, (gb|DY516773.1|), blast E-value=4e-29, identity=95.24% | |
| 298-420, AL577988 Homo sapiens HELA CELLS COT 25-NORMALIZED Homo sapiens (emb|AL577988.3|), blast E-value=2e-28, identity=89.43% | |
| 298-420, BX365643 Homo sapiens HELA CELLS COT 25-NORMALIZED Homo sapiens (emb|BX365643.2|), blast E-value=2e-28, identity=89.43% | |
| 298-420, AGENCOURT_15342796 Lupski_anterior_horn Homo sapiens cDNA clone (gb|CF454722.1|), blast E-value=2e-28, identity=89.43% | |
| 298-420, if25c01.y5 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens (gb|CK819816.1|), blast E-value=2e-28, identity=89.43% | |
| 319-415, LIB5338-011-A1-K1-G4 LIB5338 Canis familiaris cDNA clone (gb|DN444560.1|), blast E-value=2e-34, identity=94.85% | |
| 298-381, sh3P0035K18_F.ab1 adult sheep fracture callus 10d Ovis aries cDNA, (gb|DY516773.1|), blast E-value=4e-29, identity=95.24% |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
| 298-420, AL577988 Homo sapiens HELA CELLS COT 25-NORMALIZED Homo sapiens (emb|AL577988.3|), blast E-value=2e-28, identity=89.43% | |
| 298-420, BX365643 Homo sapiens HELA CELLS COT 25-NORMALIZED Homo sapiens (emb|BX365643.2|), blast E-value=2e-28, identity=89.43% | |
| 298-420, AGENCOURT_15342796 Lupski_anterior_horn Homo sapiens cDNA clone (gb|CF454722.1|), blast E-value=2e-28, identity=89.43% | |
| 298-420, if25c01.y5 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens (gb|CK819816.1|), blast E-value=2e-28, identity=89.43% | |
| 319-415, LIB5338-011-A1-K1-G4 LIB5338 Canis familiaris cDNA clone (gb|DN444560.1|), blast E-value=2e-34, identity=94.85% | |
| 298-381, sh3P0035K18_F.ab1 adult sheep fracture callus 10d Ovis aries cDNA, (gb|DY516773.1|), blast E-value=4e-29, identity=95.24% | |
| 298-420, AL577988 Homo sapiens HELA CELLS COT 25-NORMALIZED Homo sapiens (emb|AL577988.3|), blast E-value=2e-28, identity=89.43% | |
| 298-420, BX365643 Homo sapiens HELA CELLS COT 25-NORMALIZED Homo sapiens (emb|BX365643.2|), blast E-value=2e-28, identity=89.43% | |
| 298-420, AGENCOURT_15342796 Lupski_anterior_horn Homo sapiens cDNA clone (gb|CF454722.1|), blast E-value=2e-28, identity=89.43% | |
| 298-420, if25c01.y5 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens (gb|CK819816.1|), blast E-value=2e-28, identity=89.43% | |
| 319-415, LIB5338-011-A1-K1-G4 LIB5338 Canis familiaris cDNA clone (gb|DN444560.1|), blast E-value=2e-34, identity=94.85% | |
| 298-381, sh3P0035K18_F.ab1 adult sheep fracture callus 10d Ovis aries cDNA, (gb|DY516773.1|), blast E-value=4e-29, identity=95.24% |
| Aligned organism(s): 11 entry(ies) | More info |
| Aligned organism(s): 11 entry(ies) | Help | Less info |
| 7-420, gnl|bosTau2|chr21 (12178259-12177842) | |
| 7-420, gnl|canFam2|chr3 (56219762-56219182) | |
| 7-420, gnl|echTel1|scaffold_308727 (38740-38168) | |
| 7-420, gnl|hg17|chr15 (89226243-89226870) | |
| 7-420, gnl|Hg17|chr15 (89226458-89226901) | |
| 7-420, gnl|loxAfr1|scaffold_34158 (22036-22699) | |
| 7-420, gnl|mm7|chr7 (76262020-76261441) | |
| 7-420, gnl|Mm7|chr7 (76261842-76261408) | |
| 7-420, gnl|monDom2|scaffold_45 (9894976-9895995) | |
| 7-420, gnl|panTro1|chr16 (90176765-90177392) | |
| 7-420, gnl|rn3|chr1 (136289694-136289155) |
| Aligned organism(s): 11 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 7-420, gnl|bosTau2|chr21 (12178259-12177842) | |
| 7-420, gnl|canFam2|chr3 (56219762-56219182) | |
| 7-420, gnl|echTel1|scaffold_308727 (38740-38168) | |
| 7-420, gnl|hg17|chr15 (89226243-89226870) | |
| 7-420, gnl|Hg17|chr15 (89226458-89226901) | |
| 7-420, gnl|loxAfr1|scaffold_34158 (22036-22699) | |
| 7-420, gnl|mm7|chr7 (76262020-76261441) | |
| 7-420, gnl|Mm7|chr7 (76261842-76261408) | |
| 7-420, gnl|monDom2|scaffold_45 (9894976-9895995) | |
| 7-420, gnl|panTro1|chr16 (90176765-90177392) | |
| 7-420, gnl|rn3|chr1 (136289694-136289155) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| ese (0.126502) |