Non-Coding RNA Search

Ss1.1-rfat0122_i12.5

Sequence:


               
               TTGCATGGGGGGTTGCTGAGGTAGGCACAAGAAGAAATCGGACATAAAGCACAAGGAAAA
CTGTTTGAGTGGATTGGTTGCTGCTCACTAAAGTTCTTCCCCGATCTCCAAATATGGAGG
TCATTACCGAGAAATGGCTTAGATGTGAATGAGAGCCAGATCCCTGTGGCTCCACCGCGT
GAGCCAGTGAATTGTGGCTAATTCGGCTGTTTCGGCCACTGGTTGGCTGGATTTTAAACC
ATAAAACTTGAAGATAGCTACAAAAGGAACAGTTTGGCTACAAGCCTGAGCTTTAATGGA
ACATACGTCCTCACAGAAAAGTTGGAAGTAACCAAAACTGAAGTTTTCATCTACCTTCAG
TTTAGTCTGTGGATTTGTTCAAATACTAAAGATCCTCAGGTCCAGAATTCCAGCATCATT
TATTCTTTTAAAATAAATTTTTAAGAACTTGATCCGTTGTATCAGTACCTCACAATCAAA
GTTGGCAAATGATGGATGAGTGATTCAAGCAGCGTGCCCTTTGGAAGCTGAAATCCATCT
GGATGGAGCCGAAGTGAACGTGAATATGCTGACTATATCCTGGAAGCATTTTTATACCAT
CTTGCGATTTCAACAAACTGGCTTTTGCCAGTTTATCCAGCTGTCTTTCAAGAATAAAAG
TTGGGGTTTTCAAAAAAAAAAAAA

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               TTGCATGGGGGGTTGCTGAGGTAGGCACAAGAAGAAATCGGACATAAAGCACAAGGAAAA
CTGTTTGAGTGGATTGGTTGCTGCTCACTAAAGTTCTTCCCCGATCTCCAAATATGGAGG
TCATTACCGAGAAATGGCTTAGATGTGAATGAGAGCCAGATCCCTGTGGCTCCACCGCGT
GAGCCAGTGAATTGTGGCTAATTCGGCTGTTTCGGCCACTGGTTGGCTGGATTTTAAACC
ATAAAACTTGAAGATAGCTACAAAAGGAACAGTTTGGCTACAAGCCTGAGCTTTAATGGA
ACATACGTCCTCACAGAAAAGTTGGAAGTAACCAAAACTGAAGTTTTCATCTACCTTCAG
TTTAGTCTGTGGATTTGTTCAAATACTAAAGATCCTCAGGTCCAGAATTCCAGCATCATT
TATTCTTTTAAAATAAATTTTTAAGAACTTGATCCGTTGTATCAGTACCTCACAATCAAA
GTTGGCAAATGATGGATGAGTGATTCAAGCAGCGTGCCCTTTGGAAGCTGAAATCCATCT
GGATGGAGCCGAAGTGAACGTGAATATGCTGACTATATCCTGGAAGCATTTTTATACCAT
CTTGCGATTTCAACAAACTGGCTTTTGCCAGTTTATCCAGCTGTCTTTCAAGAATAAAAG
TTGGGGTTTTCAAAAAAAAAAAAA

Predicted RNA structure(s): 3 entry(ies)

More info

Predicted RNA structure(s): 3 entry(ies)

Help | Less info


               
               41-238, - strand, RNAz p=0.961515
               

               
               278-437, - strand, RNAz p=0.99835
               

               
               517-673, + strand, RNAz p=0.980503

Predicted RNA structure(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               41-238, - strand, RNAz p=0.961515
               

               
               278-437, - strand, RNAz p=0.99835
               

               
               517-673, + strand, RNAz p=0.980503

Predicted microRNA(s): 1 entry(ies)

More info

Predicted microRNA(s): 1 entry(ies)

Help | Less info


               
               593-666, + strand, RNAmicro p=0.972085

Predicted microRNA(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro


               
               593-666, + strand, RNAmicro p=0.972085

Similar Transcript(s): 12 entry(ies)

More info

Similar Transcript(s): 12 entry(ies)

Help | Less info


               
               278-437, AM019408 KN-252-liver, Bos indicus Bos indicus cDNA clone 
(emb|AM019408.1|), blast E-value=0, identity=95% 
               

               
               278-437, MLN1_6_B12.g1_A009 Mesenteric lymph node (MLN1) Equus caballus 
(gb|BM781290.1|), blast E-value=0, identity=96.25% 
               

               
               278-437, CT020005A10B07 Equine Articular Cartilage cDNA Library Equus 
(gb|CX593400.1|), blast E-value=0, identity=96.25% 
               

               
               278-437, HL01019A2G11 Equine lymphocyte cDNA Library Equus caballus cDNA 
(gb|DN506853.1|), blast E-value=0, identity=96.25% 
               

               
               278-437, POSM0605004_C16F porcine skeletal muscle cDNA library (PoSM) Sus 
(gb|DV904728.1|), blast E-value=0, identity=100% 
               

               
               278-435, POSM0605004_C16R porcine skeletal muscle cDNA library (PoSM) Sus 
(gb|DV904729.1|), blast E-value=0, identity=99.37% 
               

               
               524-671, AM014599 KN-252-liver, Bos taurus Bos taurus cDNA clone C0007413p09 
(emb|AM014599.1|), blast E-value=0, identity=95.95% 
               

               
               524-671, AM019408 KN-252-liver, Bos indicus Bos indicus cDNA clone 
(emb|AM019408.1|), blast E-value=0, identity=95.95% 
               

               
               524-673, 156333 MARC 4BOV Bos taurus cDNA 5', mRNA sequence (gb|BE667995.1|), 
blast E-value=0, identity=96% 
               

               
               524-673, 4095849 BARC 10BOV Bos taurus cDNA clone 10BOV35_C08 3', mRNA 
(gb|CK955821.1|), blast E-value=0, identity=96% 
               

               
               517-673, HL01019A2G11 Equine lymphocyte cDNA Library Equus caballus cDNA 
(gb|DN506853.1|), blast E-value=0, identity=96.18% 
               

               
               517-669, POSM0605004_C16F porcine skeletal muscle cDNA library (PoSM) Sus 
(gb|DV904728.1|), blast E-value=0, identity=98.69%

Similar Transcript(s): 12 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               278-437, AM019408 KN-252-liver, Bos indicus Bos indicus cDNA clone 
(emb|AM019408.1|), blast E-value=0, identity=95% 
               

               
               278-437, MLN1_6_B12.g1_A009 Mesenteric lymph node (MLN1) Equus caballus 
(gb|BM781290.1|), blast E-value=0, identity=96.25% 
               

               
               278-437, CT020005A10B07 Equine Articular Cartilage cDNA Library Equus 
(gb|CX593400.1|), blast E-value=0, identity=96.25% 
               

               
               278-437, HL01019A2G11 Equine lymphocyte cDNA Library Equus caballus cDNA 
(gb|DN506853.1|), blast E-value=0, identity=96.25% 
               

               
               278-437, POSM0605004_C16F porcine skeletal muscle cDNA library (PoSM) Sus 
(gb|DV904728.1|), blast E-value=0, identity=100% 
               

               
               278-435, POSM0605004_C16R porcine skeletal muscle cDNA library (PoSM) Sus 
(gb|DV904729.1|), blast E-value=0, identity=99.37% 
               

               
               524-671, AM014599 KN-252-liver, Bos taurus Bos taurus cDNA clone C0007413p09 
(emb|AM014599.1|), blast E-value=0, identity=95.95% 
               

               
               524-671, AM019408 KN-252-liver, Bos indicus Bos indicus cDNA clone 
(emb|AM019408.1|), blast E-value=0, identity=95.95% 
               

               
               524-673, 156333 MARC 4BOV Bos taurus cDNA 5', mRNA sequence (gb|BE667995.1|), 
blast E-value=0, identity=96% 
               

               
               524-673, 4095849 BARC 10BOV Bos taurus cDNA clone 10BOV35_C08 3', mRNA 
(gb|CK955821.1|), blast E-value=0, identity=96% 
               

               
               517-673, HL01019A2G11 Equine lymphocyte cDNA Library Equus caballus cDNA 
(gb|DN506853.1|), blast E-value=0, identity=96.18% 
               

               
               517-669, POSM0605004_C16F porcine skeletal muscle cDNA library (PoSM) Sus 
(gb|DV904728.1|), blast E-value=0, identity=98.69%

Homologous human UTR: 1 entry(ies)

More info

Homologous human UTR: 1 entry(ies)

Help | Less info


               
               5' of NM_033224, +

Homologous human UTR: 1 entry(ies)

Help | Less info

Human gene identifier and UTR site,
human gene reading direction


               
               5' of NM_033224, +

Aligned organism(s): 3 entry(ies)

More info

Aligned organism(s): 3 entry(ies)

Help | Less info


               
               1-673, gnl|bosTau2|chr4 (43135360-43134703)
               

               
               1-673, gnl|Hg17|chr7 (44696439-44695777)
               

               
               1-673, gnl|Mm7|chr11 (6426091-6425423)

Aligned organism(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               1-673, gnl|bosTau2|chr4 (43135360-43134703)
               

               
               1-673, gnl|Hg17|chr7 (44696439-44695777)
               

               
               1-673, gnl|Mm7|chr11 (6426091-6425423)

Expressed library(ies): 2 entry(ies)

More info

Expressed library(ies): 2 entry(ies)

Help | Less info


               
               fat (0.294855)
               

               
               mga (0.160205)

Expressed library(ies): 2 entry(ies)

Help | Less info

Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description


               
               fat (0.294855)
               

               
               mga (0.160205)

	41-238, - strand, RNAz p=0.961515
	278-437, - strand, RNAz p=0.99835
	517-673, + strand, RNAz p=0.980503

	278-437, AM019408 KN-252-liver, Bos indicus Bos indicus cDNA clone (emb\|AM019408.1\|), blast E-value=0, identity=95%
	278-437, MLN1_6_B12.g1_A009 Mesenteric lymph node (MLN1) Equus caballus (gb\|BM781290.1\|), blast E-value=0, identity=96.25%
	278-437, CT020005A10B07 Equine Articular Cartilage cDNA Library Equus (gb\|CX593400.1\|), blast E-value=0, identity=96.25%
	278-437, HL01019A2G11 Equine lymphocyte cDNA Library Equus caballus cDNA (gb\|DN506853.1\|), blast E-value=0, identity=96.25%
	278-437, POSM0605004_C16F porcine skeletal muscle cDNA library (PoSM) Sus (gb\|DV904728.1\|), blast E-value=0, identity=100%
	278-435, POSM0605004_C16R porcine skeletal muscle cDNA library (PoSM) Sus (gb\|DV904729.1\|), blast E-value=0, identity=99.37%
	524-671, AM014599 KN-252-liver, Bos taurus Bos taurus cDNA clone C0007413p09 (emb\|AM014599.1\|), blast E-value=0, identity=95.95%
	524-671, AM019408 KN-252-liver, Bos indicus Bos indicus cDNA clone (emb\|AM019408.1\|), blast E-value=0, identity=95.95%
	524-673, 156333 MARC 4BOV Bos taurus cDNA 5', mRNA sequence (gb\|BE667995.1\|), blast E-value=0, identity=96%
	524-673, 4095849 BARC 10BOV Bos taurus cDNA clone 10BOV35_C08 3', mRNA (gb\|CK955821.1\|), blast E-value=0, identity=96%
	517-673, HL01019A2G11 Equine lymphocyte cDNA Library Equus caballus cDNA (gb\|DN506853.1\|), blast E-value=0, identity=96.18%
	517-669, POSM0605004_C16F porcine skeletal muscle cDNA library (PoSM) Sus (gb\|DV904728.1\|), blast E-value=0, identity=98.69%

	1-673, gnl\|bosTau2\|chr4 (43135360-43134703)
	1-673, gnl\|Hg17\|chr7 (44696439-44695777)
	1-673, gnl\|Mm7\|chr11 (6426091-6425423)