Ss1.1-rfbs3926b_c4.5
|
GGGCTAGAGCGACATCATGGTATTCCCCGGCCCCTGGAAGAAAGGAAGAGAGTTAGGTGT
TAACATGATCACTAAATAGTGCAATACAAGCCCCTCCTTCTTTCTTCCAGGGGCCGGGCT
AGAGCGACATCATGGTATTCCCCTTACTAAAAAAAGTGTGTATTAGGAGGAGAGAGAGGA
AAAAAAGAGAAAAGAAGGAAAAAAAAAAGAATTAAAAAAAAAAAAAAA
|
Blue-coloured subsequences are predicted RNA structures by RNAz
|
GGGCTAGAGCGACATCATGGTATTCCCCGGCCCCTGGAAGAAAGGAAGAGAGTTAGGTGT
TAACATGATCACTAAATAGTGCAATACAAGCCCCTCCTTCTTTCTTCCAGGGGCCGGGCT
AGAGCGACATCATGGTATTCCCCTTACTAAAAAAAGTGTGTATTAGGAGGAGAGAGAGGA
AAAAAAGAGAAAAGAAGGAAAAAAAAAAGAATTAAAAAAAAAAAAAAA
|
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
|
94-178, BP479054 Rattus norvegicus pancreatic islet Rattus norvegicus cDNA
(dbj|BP479054.1|), blast E-value=9e-27, identity=91.76% |
|
94-178, BP486964 Rattus norvegicus insulinoma RINm5F Rattus norvegicus cDNA
(dbj|BP486964.1|), blast E-value=9e-27, identity=91.76% |
|
94-178, DB813163 full-length enriched swine cDNA library, adult ovary Sus
(dbj|DB813163.1|), blast E-value=9e-27, identity=91.76% |
|
94-178, DB816541 full-length enriched swine cDNA library, adult spleen Sus
(dbj|DB816541.1|), blast E-value=9e-27, identity=91.76% |
|
94-178, DB818046 full-length enriched swine cDNA library, adult thymus Sus
(dbj|DB818046.1|), blast E-value=9e-27, identity=91.76% |
|
94-178, RVL24542 Wackym-Soares normalized rat vestibular cDNA library
(gb|DY473139.1|), blast E-value=9e-27, identity=91.76% |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
|
94-178, BP479054 Rattus norvegicus pancreatic islet Rattus norvegicus cDNA
(dbj|BP479054.1|), blast E-value=9e-27, identity=91.76% |
|
94-178, BP486964 Rattus norvegicus insulinoma RINm5F Rattus norvegicus cDNA
(dbj|BP486964.1|), blast E-value=9e-27, identity=91.76% |
|
94-178, DB813163 full-length enriched swine cDNA library, adult ovary Sus
(dbj|DB813163.1|), blast E-value=9e-27, identity=91.76% |
|
94-178, DB816541 full-length enriched swine cDNA library, adult spleen Sus
(dbj|DB816541.1|), blast E-value=9e-27, identity=91.76% |
|
94-178, DB818046 full-length enriched swine cDNA library, adult thymus Sus
(dbj|DB818046.1|), blast E-value=9e-27, identity=91.76% |
|
94-178, RVL24542 Wackym-Soares normalized rat vestibular cDNA library
(gb|DY473139.1|), blast E-value=9e-27, identity=91.76% |
Human gene identifier and UTR site,
human gene reading direction
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
