Ss1.1-rfce25c_i6.5
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGTGTTGAAGGGCTTTATTGGGG CTGCCCTGAGCCCCTCACAGTGTTACAGGAACCCACTGGTCTTGCCGTTGCCTCTGTTCT TGGGGGTCTTGGGAGGGAAGGCAGGAGGAGGACCAGCTTTCCTGGCACAGAGAAGGCCCT TCTGTGGGGTGGGACCAGGAGGTGGGAGAAGTGGAAAATTCAGGACGAGCCGGGCCGCAA GCCCTAATAACCCTTCCCACATTT |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGTGTTGAAGGGCTTTATTGGGG CTGCCCTGAGCCCCTCACAGTGTTACAGGAACCCACTGGTCTTGCCGTTGCCTCTGTTCT TGGGGGTCTTGGGAGGGAAGGCAGGAGGAGGACCAGCTTTCCTGGCACAGAGAAGGCCCT TCTGTGGGGTGGGACCAGGAGGTGGGAGAAGTGGAAAATTCAGGACGAGCCGGGCCGCAA GCCCTAATAACCCTTCCCACATTT |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 51-207, - strand, RNAz p=0.999046 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 51-207, - strand, RNAz p=0.999046 |
| Predicted microRNA(s): 2 entry(ies) | More info |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
| 87-165, + strand, RNAmicro p=0.998471 | |
| 70-212, - strand, RNAmicro p=0.986628 |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 87-165, + strand, RNAmicro p=0.998471 | |
| 70-212, - strand, RNAmicro p=0.986628 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 3' of NM_138387, - |
| Aligned organism(s): 2 entry(ies) | More info |
| Aligned organism(s): 2 entry(ies) | Help | Less info |
| 11-222, gnl|bosTau2|chr1 (14603973-14603767) | |
| 11-222, gnl|Hg17|chr17 (39509235-39509051) |
| Aligned organism(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 11-222, gnl|bosTau2|chr1 (14603973-14603767) | |
| 11-222, gnl|Hg17|chr17 (39509235-39509051) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| fce (0.271592) |