Ss1.1-rfli704b_k10.5
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GGCACGAGCCTGGGAAGTGCTTTTATAAATTATTTTCCTTGTAGATTTTATTTTTAATTT ATCTCTGTGACCTGCCAGGGAGAGGGGGGAGAGAGAGAGAGAGAGAGAGATGCTGTGAGC ACATGACAAAATAAAATAAAATAAAATGGATGATTCATTCTCAAAAAAAAAAAAAAAAAA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GGCACGAGCCTGGGAAGTGCTTTTATAAATTATTTTCCTTGTAGATTTTATTTTTAATTT ATCTCTGTGACCTGCCAGGGAGAGGGGGGAGAGAGAGAGAGAGAGAGAGATGCTGTGAGC ACATGACAAAATAAAATAAAATAAAATGGATGATTCATTCTCAAAAAAAAAAAAAAAAAA |
| Predicted RNA structure(s): 2 entry(ies) | More info |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
| 40-158, - strand, RNAz p=0.930671 | |
| 44-157, - strand, RNAz p=0.991192 |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 40-158, - strand, RNAz p=0.930671 | |
| 44-157, - strand, RNAz p=0.991192 |
| Similar Transcript(s): 6 entry(ies) | More info |
| Similar Transcript(s): 6 entry(ies) | Help | Less info |
| 44-88, AU296049 full-length enriched pig cDNA library, main and accessory (dbj|AU296049.1|), blast E-value=0.000000000000002, identity=100% | |
| 44-87, BP390464 Homo sapiens pancreatic islet Homo sapiens cDNA clone (dbj|BP390464.1|), blast E-value=0.000000000000007, identity=100% | |
| 44-87, DB257785 UTERU2 Homo sapiens cDNA clone UTERU2014097 5', mRNA (dbj|DB257785.1|), blast E-value=0.000000000000007, identity=100% | |
| 44-87, DB507683 RIKEN full-length enriched human cDNA library, testis Homo (dbj|DB507683.1|), blast E-value=0.000000000000007, identity=100% | |
| 44-88, od01d09.y1 Human keratoconus cornea, unamplified, (od/oe) Homo (gb|CV569100.1|), blast E-value=0.000000000000002, identity=100% | |
| 44-88, PADT0811028_F13F porcine adipose tissue cDNA library (PADT) Sus (gb|EB422281.1|), blast E-value=0.000000000000002, identity=100% |
| Similar Transcript(s): 6 entry(ies) | Help | Less info |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
| 44-88, AU296049 full-length enriched pig cDNA library, main and accessory (dbj|AU296049.1|), blast E-value=0.000000000000002, identity=100% | |
| 44-87, BP390464 Homo sapiens pancreatic islet Homo sapiens cDNA clone (dbj|BP390464.1|), blast E-value=0.000000000000007, identity=100% | |
| 44-87, DB257785 UTERU2 Homo sapiens cDNA clone UTERU2014097 5', mRNA (dbj|DB257785.1|), blast E-value=0.000000000000007, identity=100% | |
| 44-87, DB507683 RIKEN full-length enriched human cDNA library, testis Homo (dbj|DB507683.1|), blast E-value=0.000000000000007, identity=100% | |
| 44-88, od01d09.y1 Human keratoconus cornea, unamplified, (od/oe) Homo (gb|CV569100.1|), blast E-value=0.000000000000002, identity=100% | |
| 44-88, PADT0811028_F13F porcine adipose tissue cDNA library (PADT) Sus (gb|EB422281.1|), blast E-value=0.000000000000002, identity=100% |
| Aligned organism(s): 25 entry(ies) | More info |
| Aligned organism(s): 25 entry(ies) | Help | Less info |
| 1-164, gnl|bosTau2|chr19 (31091021-31090871) | |
| 1-164, gnl|canFam2|chr9 (27684389-27684715) | |
| 1-164, gnl|canFam2|chr9 (27684733-27684389) | |
| 1-164, gnl|dasNov1|scaffold_5875 (4368-4677) | |
| 1-164, gnl|dasNov1|scaffold_5875 (4695-4373) | |
| 1-164, gnl|echTel1|scaffold_312618 (46340-46629) | |
| 1-164, gnl|echTel1|scaffold_312618 (46646-46340) | |
| 1-164, gnl|hg17|chr12 (22320749-22321074) | |
| 1-164, gnl|Hg17|chr17 (43493700-43493848) | |
| 1-164, gnl|hg17|chr9 (122799732-122800050) | |
| 1-164, gnl|loxAfr1|scaffold_230065 (1020-738) | |
| 1-164, gnl|loxAfr1|scaffold_230065 (723-1020) | |
| 1-164, gnl|mm7|chr11 (96926828-96926475) | |
| 1-164, gnl|mm7|chr11 (96926464-96926828) | |
| 1-164, gnl|Mm7|chr11 (96926605-96926457) | |
| 1-164, gnl|monDom2|scaffold_18 (46321583-46321225) | |
| 1-164, gnl|monDom2|scaffold_18 (46321216-46321583) | |
| 1-164, gnl|oryCun1|scaffold_188583 (3799-4095) | |
| 1-164, gnl|oryCun1|scaffold_188583 (4113-3799) | |
| 1-164, gnl|panTro1|chr19_random (42430561-42430243) | |
| 1-164, gnl|panTro1|chrUn_random (48703058-48703384) | |
| 1-164, gnl|rheMac2|chr11 (22605830-22606171) | |
| 1-164, gnl|rheMac2|chr16 (32277051-32276737) | |
| 1-164, gnl|rn3|chr10 (85589248-85588928) | |
| 1-164, gnl|rn3|chr10 (85588917-85589248) |
| Aligned organism(s): 25 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-164, gnl|bosTau2|chr19 (31091021-31090871) | |
| 1-164, gnl|canFam2|chr9 (27684389-27684715) | |
| 1-164, gnl|canFam2|chr9 (27684733-27684389) | |
| 1-164, gnl|dasNov1|scaffold_5875 (4368-4677) | |
| 1-164, gnl|dasNov1|scaffold_5875 (4695-4373) | |
| 1-164, gnl|echTel1|scaffold_312618 (46340-46629) | |
| 1-164, gnl|echTel1|scaffold_312618 (46646-46340) | |
| 1-164, gnl|hg17|chr12 (22320749-22321074) | |
| 1-164, gnl|Hg17|chr17 (43493700-43493848) | |
| 1-164, gnl|hg17|chr9 (122799732-122800050) | |
| 1-164, gnl|loxAfr1|scaffold_230065 (1020-738) | |
| 1-164, gnl|loxAfr1|scaffold_230065 (723-1020) | |
| 1-164, gnl|mm7|chr11 (96926828-96926475) | |
| 1-164, gnl|mm7|chr11 (96926464-96926828) | |
| 1-164, gnl|Mm7|chr11 (96926605-96926457) | |
| 1-164, gnl|monDom2|scaffold_18 (46321583-46321225) | |
| 1-164, gnl|monDom2|scaffold_18 (46321216-46321583) | |
| 1-164, gnl|oryCun1|scaffold_188583 (3799-4095) | |
| 1-164, gnl|oryCun1|scaffold_188583 (4113-3799) | |
| 1-164, gnl|panTro1|chr19_random (42430561-42430243) | |
| 1-164, gnl|panTro1|chrUn_random (48703058-48703384) | |
| 1-164, gnl|rheMac2|chr11 (22605830-22606171) | |
| 1-164, gnl|rheMac2|chr16 (32277051-32276737) | |
| 1-164, gnl|rn3|chr10 (85589248-85588928) | |
| 1-164, gnl|rn3|chr10 (85588917-85589248) |
| Expressed library(ies): 2 entry(ies) | More info |
| Expressed library(ies): 2 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| fli (0.202881) | |
| eye (0.170503) |