Ss1.1-rjca09c_j20.5
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CGAGACGGCGTCTCCTGCGAGGCCTCCAACCCCCACGGGAACGACCGGCACGTCTTCCAC TTCGGCACCGTGGCCCCCCAGACCTCCCAGGCCGGAGTGGCGGTCATGGCCGTGGCTGTC AGCGTGGGCCTCCTGCTCCTCGTCGTTGCTGCTTTCTACTGCATGAGACGCAAGGGACAC CGCTGCTGCCGGCAAGGGGAAAAGGGGTCCCCGCTTCCTGGGGAGCCAGAACTGAGCCAC TCGGGGTCAGAGGGGCCGGAGCAGACGGGCCTTCTCATGGGGGGTGCCTCTGGAGGAGCC AAGCATGGGAGTGGGGGCTTCGGAGATGAGTGCTAAGCCCGAGGCATTCACAGGAGCAGT TAAGGAACCCGACCTGGAGTCGTGGGCACCAGAAAACCAGTCCTGCGCGTGCGCCTCCAC CCGCCCCTGCCTTCCTGGCCTTCCCTCTTCCCTCTCGGGCCCTCCCTTCCTTCCTCTGGA GGCTGGGCAGGGACCACAGCCGCTTGCCTGCCTCTGCTGGGAGGGAGGGGACCTTCCTTC AGGGAGTATGACTCTCCCAGGCCCCAGAATAGCTCCTGGACCCAAGCCCAAGGCCCGGCC TGGGACGAAGCTCCGAGGGTCGGCTGGCCGGGGCTATTTTTACCTCCTGCCTCCATCGCT GGTTCCCCCCACCTGACGTCCTGCTGCAGAGTCTGACACTGGATCCCCACCCCCGCCCCG CCCCCGCCCCCGCCCCATCATCTGTGGACACTGGAGTCTAGAATAAATGCTATCTGTCAC GTGGACACCAAA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CGAGACGGCGTCTCCTGCGAGGCCTCCAACCCCCACGGGAACGACCGGCACGTCTTCCAC TTCGGCACCGTGGCCCCCCAGACCTCCCAGGCCGGAGTGGCGGTCATGGCCGTGGCTGTC AGCGTGGGCCTCCTGCTCCTCGTCGTTGCTGCTTTCTACTGCATGAGACGCAAGGGACAC CGCTGCTGCCGGCAAGGGGAAAAGGGGTCCCCGCTTCCTGGGGAGCCAGAACTGAGCCAC TCGGGGTCAGAGGGGCCGGAGCAGACGGGCCTTCTCATGGGGGGTGCCTCTGGAGGAGCC AAGCATGGGAGTGGGGGCTTCGGAGATGAGTGCTAAGCCCGAGGCATTCACAGGAGCAGT TAAGGAACCCGACCTGGAGTCGTGGGCACCAGAAAACCAGTCCTGCGCGTGCGCCTCCAC CCGCCCCTGCCTTCCTGGCCTTCCCTCTTCCCTCTCGGGCCCTCCCTTCCTTCCTCTGGA GGCTGGGCAGGGACCACAGCCGCTTGCCTGCCTCTGCTGGGAGGGAGGGGACCTTCCTTC AGGGAGTATGACTCTCCCAGGCCCCAGAATAGCTCCTGGACCCAAGCCCAAGGCCCGGCC TGGGACGAAGCTCCGAGGGTCGGCTGGCCGGGGCTATTTTTACCTCCTGCCTCCATCGCT GGTTCCCCCCACCTGACGTCCTGCTGCAGAGTCTGACACTGGATCCCCACCCCCGCCCCG CCCCCGCCCCCGCCCCATCATCTGTGGACACTGGAGTCTAGAATAAATGCTATCTGTCAC GTGGACACCAAA |
| Predicted RNA structure(s): 2 entry(ies) | More info |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
| 364-552, - strand, RNAz p=0.992628 | |
| 441-656, - strand, RNAz p=0.991054 |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 364-552, - strand, RNAz p=0.992628 | |
| 441-656, - strand, RNAz p=0.991054 |
| Similar Transcript(s): 12 entry(ies) | More info |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
| 364-552, PADT0811009_M16R porcine adipose tissue cDNA library (PADT) Sus (gb|EB414885.1|), blast E-value=0, identity=100% | |
| 364-552, PADT0811010_O16R porcine adipose tissue cDNA library (PADT) Sus (gb|EB415495.1|), blast E-value=0, identity=97.35% | |
| 364-542, PADT0811023_M07R porcine adipose tissue cDNA library (PADT) Sus (gb|EB420099.1|), blast E-value=0, identity=100% | |
| 364-539, PADT0811026_D20R porcine adipose tissue cDNA library (PADT) Sus (gb|EB421389.1|), blast E-value=0, identity=100% | |
| 364-552, PADT08110T2_C05R porcine adipose tissue cDNA library (PADT) Sus (gb|EB424162.1|), blast E-value=0, identity=100% | |
| 364-552, PADT08110T2_M20R porcine adipose tissue cDNA library (PADT) Sus (gb|EB424498.1|), blast E-value=0, identity=99.47% | |
| 441-656, PADT0811009_M16R porcine adipose tissue cDNA library (PADT) Sus (gb|EB414885.1|), blast E-value=0, identity=100% | |
| 441-656, PADT0811010_O16R porcine adipose tissue cDNA library (PADT) Sus (gb|EB415495.1|), blast E-value=0, identity=97.22% | |
| 518-656, PADT0811024_F17F porcine adipose tissue cDNA library (PADT) Sus (gb|EB420378.1|), blast E-value=0, identity=100% | |
| 518-656, PADT0811028_P15F porcine adipose tissue cDNA library (PADT) Sus (gb|EB422426.1|), blast E-value=0, identity=100% | |
| 517-656, PADT08110T2_M20F porcine adipose tissue cDNA library (PADT) Sus (gb|EB424497.1|), blast E-value=0, identity=100% | |
| 441-656, PADT08110T2_M20R porcine adipose tissue cDNA library (PADT) Sus (gb|EB424498.1|), blast E-value=0, identity=99.54% |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
| 364-552, PADT0811009_M16R porcine adipose tissue cDNA library (PADT) Sus (gb|EB414885.1|), blast E-value=0, identity=100% | |
| 364-552, PADT0811010_O16R porcine adipose tissue cDNA library (PADT) Sus (gb|EB415495.1|), blast E-value=0, identity=97.35% | |
| 364-542, PADT0811023_M07R porcine adipose tissue cDNA library (PADT) Sus (gb|EB420099.1|), blast E-value=0, identity=100% | |
| 364-539, PADT0811026_D20R porcine adipose tissue cDNA library (PADT) Sus (gb|EB421389.1|), blast E-value=0, identity=100% | |
| 364-552, PADT08110T2_C05R porcine adipose tissue cDNA library (PADT) Sus (gb|EB424162.1|), blast E-value=0, identity=100% | |
| 364-552, PADT08110T2_M20R porcine adipose tissue cDNA library (PADT) Sus (gb|EB424498.1|), blast E-value=0, identity=99.47% | |
| 441-656, PADT0811009_M16R porcine adipose tissue cDNA library (PADT) Sus (gb|EB414885.1|), blast E-value=0, identity=100% | |
| 441-656, PADT0811010_O16R porcine adipose tissue cDNA library (PADT) Sus (gb|EB415495.1|), blast E-value=0, identity=97.22% | |
| 518-656, PADT0811024_F17F porcine adipose tissue cDNA library (PADT) Sus (gb|EB420378.1|), blast E-value=0, identity=100% | |
| 518-656, PADT0811028_P15F porcine adipose tissue cDNA library (PADT) Sus (gb|EB422426.1|), blast E-value=0, identity=100% | |
| 517-656, PADT08110T2_M20F porcine adipose tissue cDNA library (PADT) Sus (gb|EB424497.1|), blast E-value=0, identity=100% | |
| 441-656, PADT08110T2_M20R porcine adipose tissue cDNA library (PADT) Sus (gb|EB424498.1|), blast E-value=0, identity=99.54% |
| Aligned organism(s): 17 entry(ies) | More info |
| Aligned organism(s): 17 entry(ies) | Help | Less info |
| 70-213, gnl|bosTau2|chr18 (38942094-38941948) | |
| 70-213, gnl|canFam2|chr1 (113468060-113467518) | |
| 70-213, gnl|hg17|chr19 (50014494-50015005) | |
| 70-213, gnl|Hg17|chr19 (50014678-50014824) | |
| 70-213, gnl|loxAfr1|scaffold_92300 (6044-6527) | |
| 70-213, gnl|mm7|chr7 (17441128-17440575) | |
| 70-213, gnl|Mm7|chr7 (17440943-17440797) | |
| 70-213, gnl|rn3|chr1 (79147825-79147371) | |
| 329-790, gnl|bosTau2|chr18 (38940754-38940311) | |
| 329-790, gnl|canFam2|chr1 (113466665-113466258) | |
| 329-790, gnl|echTel1|scaffold_113059 (730-1072) | |
| 329-790, gnl|hg17|chr19 (50016008-50016394) | |
| 329-790, gnl|Hg17|chr19 (50016011-50016518) | |
| 329-790, gnl|mm7|chr7 (17439000-17438610) | |
| 329-790, gnl|Mm7|chr7 (17438995-17438507) | |
| 329-790, gnl|panTro1|chr20 (47154686-47155065) | |
| 329-790, gnl|rn3|chr1 (79145950-79145561) |
| Aligned organism(s): 17 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 70-213, gnl|bosTau2|chr18 (38942094-38941948) | |
| 70-213, gnl|canFam2|chr1 (113468060-113467518) | |
| 70-213, gnl|hg17|chr19 (50014494-50015005) | |
| 70-213, gnl|Hg17|chr19 (50014678-50014824) | |
| 70-213, gnl|loxAfr1|scaffold_92300 (6044-6527) | |
| 70-213, gnl|mm7|chr7 (17441128-17440575) | |
| 70-213, gnl|Mm7|chr7 (17440943-17440797) | |
| 70-213, gnl|rn3|chr1 (79147825-79147371) | |
| 329-790, gnl|bosTau2|chr18 (38940754-38940311) | |
| 329-790, gnl|canFam2|chr1 (113466665-113466258) | |
| 329-790, gnl|echTel1|scaffold_113059 (730-1072) | |
| 329-790, gnl|hg17|chr19 (50016008-50016394) | |
| 329-790, gnl|Hg17|chr19 (50016011-50016518) | |
| 329-790, gnl|mm7|chr7 (17439000-17438610) | |
| 329-790, gnl|Mm7|chr7 (17438995-17438507) | |
| 329-790, gnl|panTro1|chr20 (47154686-47155065) | |
| 329-790, gnl|rn3|chr1 (79145950-79145561) |
| Expressed library(ies): 8 entry(ies) | More info |
| Expressed library(ies): 8 entry(ies) | Help | Less info |
| cov (0.528611) | |
| pla (0.267344) | |
| ese (0.253004) | |
| jca (0.22792) | |
| nms (0.213858) | |
| cly (0.120642) | |
| clu (0.119646) | |
| eje (0.0988338) |
| Expressed library(ies): 8 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| cov (0.528611) | |
| pla (0.267344) | |
| ese (0.253004) | |
| jca (0.22792) | |
| nms (0.213858) | |
| cly (0.120642) | |
| clu (0.119646) | |
| eje (0.0988338) |