Ss1.1-rnep28c_p10.5
|
CTTGGTCCACTTGCTTGAAGACCCATGTGGGGGTAAGTCCTTTTCTGCCCGTTGGGCTTA
TGACACCCCAACTCTGCCCTTTCTGCTCCTTTCTCCATGCCTTCCTGGGGCCTCCCCTCC
ACTGCTCCCCAAATCTGAGTCTCCCCCAAAGACACAGAAAACAATGCATTGTCTGCCCAG
CAACCAAAGGCAATGCTGAAACACCCAGTGGCCCCC
|
Blue-coloured subsequences are predicted RNA structures by RNAz
|
CTTGGTCCACTTGCTTGAAGACCCATGTGGGGGTAAGTCCTTTTCTGCCCGTTGGGCTTA
TGACACCCCAACTCTGCCCTTTCTGCTCCTTTCTCCATGCCTTCCTGGGGCCTCCCCTCC
ACTGCTCCCCAAATCTGAGTCTCCCCCAAAGACACAGAAAACAATGCATTGTCTGCCCAG
CAACCAAAGGCAATGCTGAAACACCCAGTGGCCCCC
|
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
|
40-216, MLN1_6_C01.g1_A009 Mesenteric lymph node (MLN1) Equus caballus
(gb|BM781292.1|), blast E-value=0, identity=95.51% |
|
40-216, CT02040B1B05 Equine Articular Cartilage cDNA Library Equus caballus
(gb|CX605111.1|), blast E-value=0, identity=95.51% |
|
40-216, PADT0811014_L18R porcine adipose tissue cDNA library (PADT) Sus
(gb|EB417192.1|), blast E-value=0, identity=100% |
|
40-216, LB03093.CR_G02 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE389467.1|),
blast E-value=0, identity=94.38% |
|
40-216, LB030102.CR_G09 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE390324.1|),
blast E-value=0, identity=94.38% |
|
40-216, LB030105.CR_N07 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE391075.1|),
blast E-value=0, identity=94.38% |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
|
40-216, MLN1_6_C01.g1_A009 Mesenteric lymph node (MLN1) Equus caballus
(gb|BM781292.1|), blast E-value=0, identity=95.51% |
|
40-216, CT02040B1B05 Equine Articular Cartilage cDNA Library Equus caballus
(gb|CX605111.1|), blast E-value=0, identity=95.51% |
|
40-216, PADT0811014_L18R porcine adipose tissue cDNA library (PADT) Sus
(gb|EB417192.1|), blast E-value=0, identity=100% |
|
40-216, LB03093.CR_G02 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE389467.1|),
blast E-value=0, identity=94.38% |
|
40-216, LB030102.CR_G09 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE390324.1|),
blast E-value=0, identity=94.38% |
|
40-216, LB030105.CR_N07 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE391075.1|),
blast E-value=0, identity=94.38% |
|
1-216, gnl|bosTau2|chr19 (29189237-29189453) |
|
1-216, gnl|canFam2|chr9 (29507881-29508170) |
|
1-216, gnl|echTel1|scaffold_300375 (5522-5242) |
|
1-216, gnl|hg17|chr17 (45617284-45617570) |
|
1-216, gnl|Hg17|chr17 (45617586-45617371) |
|
1-216, gnl|loxAfr1|scaffold_26320 (29407-29119) |
|
1-216, gnl|mm7|chr11 (95061241-95060956) |
|
1-216, gnl|Mm7|chr11 (95060938-95061153) |
|
1-216, gnl|monDom2|scaffold_18 (43192220-43191855) |
|
1-216, gnl|oryCun1|scaffold_182892 (11713-11965) |
|
1-216, gnl|panTro1|chr19_random (31235828-31236114) |
|
1-216, gnl|rheMac2|chr16 (34423527-34423813) |
|
1-216, gnl|rn3|chr10 (83652967-83652678) |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
|
1-216, gnl|bosTau2|chr19 (29189237-29189453) |
|
1-216, gnl|canFam2|chr9 (29507881-29508170) |
|
1-216, gnl|echTel1|scaffold_300375 (5522-5242) |
|
1-216, gnl|hg17|chr17 (45617284-45617570) |
|
1-216, gnl|Hg17|chr17 (45617586-45617371) |
|
1-216, gnl|loxAfr1|scaffold_26320 (29407-29119) |
|
1-216, gnl|mm7|chr11 (95061241-95060956) |
|
1-216, gnl|Mm7|chr11 (95060938-95061153) |
|
1-216, gnl|monDom2|scaffold_18 (43192220-43191855) |
|
1-216, gnl|oryCun1|scaffold_182892 (11713-11965) |
|
1-216, gnl|panTro1|chr19_random (31235828-31236114) |
|
1-216, gnl|rheMac2|chr16 (34423527-34423813) |
|
1-216, gnl|rn3|chr10 (83652967-83652678) |
|
eep (0.245128) |
|
nep (0.183925) |
|
cov (0.132153) |
|
eru (0.120048) |
|
jca (0.11396) |
|
eep (0.245128) |
|
nep (0.183925) |
|
cov (0.132153) |
|
eru (0.120048) |
|
jca (0.11396) |
