Ss1.1-rspc021_a20.5
|
TTTTAAAAAAGTAACAAGAAAACATTTACAGATAGGAAGTAAACAATAGTGTACCGTGAT
AATGAAGGATCACTCTTGTCATAGTACTACATATAATGTAGAGTACGTAAAATGCAGTGG
TCTGACTGCAGGGGACAAAATAATGCCAAAGGCAGTCATAATAGAATCATTTTACGTACA
AAAATATTACATCACAATAAATAATTTCAAACATAAATATTAAACTTTACATCATTAGGA
TATTCCACATCTATATACACACACATATATACACACACATACATGTGTGTGTATATATGT
ATATATATATATGCATATGTACACACACACACAGACATACAAGTCCACACACACATACAG |
Blue-coloured subsequences are predicted RNA structures by RNAz
|
TTTTAAAAAAGTAACAAGAAAACATTTACAGATAGGAAGTAAACAATAGTGTACCGTGAT
AATGAAGGATCACTCTTGTCATAGTACTACATATAATGTAGAGTACGTAAAATGCAGTGG
TCTGACTGCAGGGGACAAAATAATGCCAAAGGCAGTCATAATAGAATCATTTTACGTACA
AAAATATTACATCACAATAAATAATTTCAAACATAAATATTAAACTTTACATCATTAGGA
TATTCCACATCTATATACACACACATATATACACACACATACATGTGTGTGTATATATGT
ATATATATATATGCATATGTACACACACACACAGACATACAAGTCCACACACACATACAG |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
|
105-181, + strand, RNAmicro p=0.90314 |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
|
105-181, + strand, RNAmicro p=0.90314 |
|
42-201, 690714 MARC 6BOV Bos taurus cDNA 3', mRNA sequence (gb|CB440433.1|),
blast E-value=0, identity=95.62% |
|
42-201, UMC-pd3end3-017-h02 Endometrium gilt D3 of estrous cycle pd3end Sus
(gb|CO989594.1|), blast E-value=0, identity=100% |
|
42-201, POSM0605007_C01F porcine skeletal muscle cDNA library (PoSM) Sus
(gb|DV897742.1|), blast E-value=0, identity=100% |
|
42-201, LB03016.CR_C22 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|DV929281.1|),
blast E-value=0, identity=95.62% |
|
42-201, sh2P0039D22_F.ab1 adult sheep fracture callus 7d Ovis aries cDNA,
(gb|DY500941.1|), blast E-value=0, identity=96.88% |
|
42-201, LB03092.CR_O10 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE389340.1|),
blast E-value=0, identity=95.62% |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
|
42-201, 690714 MARC 6BOV Bos taurus cDNA 3', mRNA sequence (gb|CB440433.1|),
blast E-value=0, identity=95.62% |
|
42-201, UMC-pd3end3-017-h02 Endometrium gilt D3 of estrous cycle pd3end Sus
(gb|CO989594.1|), blast E-value=0, identity=100% |
|
42-201, POSM0605007_C01F porcine skeletal muscle cDNA library (PoSM) Sus
(gb|DV897742.1|), blast E-value=0, identity=100% |
|
42-201, LB03016.CR_C22 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|DV929281.1|),
blast E-value=0, identity=95.62% |
|
42-201, sh2P0039D22_F.ab1 adult sheep fracture callus 7d Ovis aries cDNA,
(gb|DY500941.1|), blast E-value=0, identity=96.88% |
|
42-201, LB03092.CR_O10 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE389340.1|),
blast E-value=0, identity=95.62% |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
|
ret (0.128733) |
|
spc (0.113366) |
|
ret (0.128733) |
|
spc (0.113366) |
