Ss1.1-rton1224b_h18.5
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CAAGAACAAGACCTTAATCCCAAAAAAGAAAGGGCCTCCTCAACCTGCAGGTGGCCAGAA AGGGCCCTCAGGTCCTCCTTCCACCTCTAAATCCTCCTCTGGCTCTGGAAACCCTGTCCG GAAATGAGCACCCCACCTCCAGCTCCCCACAAGCCCCACAGCAATGAT |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CAAGAACAAGACCTTAATCCCAAAAAAGAAAGGGCCTCCTCAACCTGCAGGTGGCCAGAA AGGGCCCTCAGGTCCTCCTTCCACCTCTAAATCCTCCTCTGGCTCTGGAAACCCTGTCCG GAAATGAGCACCCCACCTCCAGCTCCCCACAAGCCCCACAGCAATGAT |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 40-143, + strand, RNAz p=0.640852 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 40-143, + strand, RNAz p=0.640852 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 5' of NM_015476, + |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-168, gnl|bosTau2|chr24 (14905146-14905312) | |
| 1-168, gnl|Hg17|chr18 (32630907-32630724) | |
| 1-168, gnl|Mm7|chr18 (25523692-25523542) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-168, gnl|bosTau2|chr24 (14905146-14905312) | |
| 1-168, gnl|Hg17|chr18 (32630907-32630724) | |
| 1-168, gnl|Mm7|chr18 (25523692-25523542) |
| Expressed library(ies): 2 entry(ies) | More info |
| Expressed library(ies): 2 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| ton (0.1755) | |
| cty (0.10408) |