Non-Coding RNA Search

Ss1.1-rute2106b_l1.5S

Sequence:


               
               GGAGAGGGGAGCCTCTGTGGGGGCGCCAGCCACTGCGCCCCCCAGAGATGTCAGGGGAAT
GGAGACGGCTGCTGCCCAGCCTGGCTCCCGGGGATGGTGGCTGGTCCTCGGGGGTCCTGA
GGGGTGGAGGAGGGGGCCTGGAGGTGTCTCCCCAGGTGTCAGGAAGGTGCTCGGTGGCCA
CCAGGGTGGGGC

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               GGAGAGGGGAGCCTCTGTGGGGGCGCCAGCCACTGCGCCCCCCAGAGATGTCAGGGGAAT
GGAGACGGCTGCTGCCCAGCCTGGCTCCCGGGGATGGTGGCTGGTCCTCGGGGGTCCTGA
GGGGTGGAGGAGGGGGCCTGGAGGTGTCTCCCCAGGTGTCAGGAAGGTGCTCGGTGGCCA
CCAGGGTGGGGC

Predicted RNA structure(s): 1 entry(ies)

More info

Predicted RNA structure(s): 1 entry(ies)

Help | Less info


               
               1-192, + strand, RNAz p=0.999969

Predicted RNA structure(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               1-192, + strand, RNAz p=0.999969

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               1-192, BP452970 full-length enriched swine cDNA library, adult liver Sus 
(dbj|BP452970.1|), blast E-value=0, identity=98.96% 
               

               
               1-123, DB800201 full-length enriched swine cDNA library, adult skin Sus 
(dbj|DB800201.1|), blast E-value=0, identity=98.37% 
               

               
               1-192, DB804617 full-length enriched swine cDNA library, adult skin Sus 
(dbj|DB804617.1|), blast E-value=0, identity=97.92% 
               

               
               1-192, sh3P0014H07_F.ab1 adult sheep fracture callus 10d Ovis aries cDNA, 
(gb|DY510110.1|), blast E-value=0, identity=89.18% 
               

               
               1-192, LB03098.CR_I23 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE392152.1|), 
blast E-value=0, identity=88.66% 
               

               
               1-192, LB03098.CR_L20 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE392190.1|), 
blast E-value=0, identity=88.66%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               1-192, BP452970 full-length enriched swine cDNA library, adult liver Sus 
(dbj|BP452970.1|), blast E-value=0, identity=98.96% 
               

               
               1-123, DB800201 full-length enriched swine cDNA library, adult skin Sus 
(dbj|DB800201.1|), blast E-value=0, identity=98.37% 
               

               
               1-192, DB804617 full-length enriched swine cDNA library, adult skin Sus 
(dbj|DB804617.1|), blast E-value=0, identity=97.92% 
               

               
               1-192, sh3P0014H07_F.ab1 adult sheep fracture callus 10d Ovis aries cDNA, 
(gb|DY510110.1|), blast E-value=0, identity=89.18% 
               

               
               1-192, LB03098.CR_I23 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE392152.1|), 
blast E-value=0, identity=88.66% 
               

               
               1-192, LB03098.CR_L20 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE392190.1|), 
blast E-value=0, identity=88.66%

Homologous human UTR: 1 entry(ies)

More info

Homologous human UTR: 1 entry(ies)

Help | Less info


               
               3' of NM_001007139, +

Homologous human UTR: 1 entry(ies)

Help | Less info

Human gene identifier and UTR site,
human gene reading direction


               
               3' of NM_001007139, +

Aligned organism(s): 3 entry(ies)

More info

Aligned organism(s): 3 entry(ies)

Help | Less info


               
               1-192, gnl|bosTau2|chr29 (44324133-44323940)
               

               
               1-192, gnl|Hg17|chr11 (2108203-2108011)
               

               
               1-192, gnl|Mm7|chr7 (139079293-139079105)

Aligned organism(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               1-192, gnl|bosTau2|chr29 (44324133-44323940)
               

               
               1-192, gnl|Hg17|chr11 (2108203-2108011)
               

               
               1-192, gnl|Mm7|chr7 (139079293-139079105)

Expressed library(ies): 1 entry(ies)

More info

Expressed library(ies): 1 entry(ies)

Help | Less info


               
               ute (0.132784)

Expressed library(ies): 1 entry(ies)

Help | Less info

Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description


               
               ute (0.132784)

	1-192, BP452970 full-length enriched swine cDNA library, adult liver Sus (dbj\|BP452970.1\|), blast E-value=0, identity=98.96%
	1-123, DB800201 full-length enriched swine cDNA library, adult skin Sus (dbj\|DB800201.1\|), blast E-value=0, identity=98.37%
	1-192, DB804617 full-length enriched swine cDNA library, adult skin Sus (dbj\|DB804617.1\|), blast E-value=0, identity=97.92%
	1-192, sh3P0014H07_F.ab1 adult sheep fracture callus 10d Ovis aries cDNA, (gb\|DY510110.1\|), blast E-value=0, identity=89.18%
	1-192, LB03098.CR_I23 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb\|EE392152.1\|), blast E-value=0, identity=88.66%
	1-192, LB03098.CR_L20 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb\|EE392190.1\|), blast E-value=0, identity=88.66%

	1-192, gnl\|bosTau2\|chr29 (44324133-44323940)
	1-192, gnl\|Hg17\|chr11 (2108203-2108011)
	1-192, gnl\|Mm7\|chr7 (139079293-139079105)