Non-Coding RNA Search

Ss1.1-uFN-UNL-P-FN-br-g-05-0-UNL.s1.3

Sequence:


               
               TCCCCACATGCTTCCTGACCCTTGACGGCCAAGGGCAAATATGTTGGTACAAAAAGGTTC
AAGAGCCCTGATAACTCCCCGGTTCATACACTACAGGTGCCCCGGTCCCCTGGGCAGGGG
ATTCAGGCTCCATTACCTCCCCAAGGGGCTCTTATGGTCAGCCCCACCCCTGGGGGCCAT
TTCCCCATTAACCACCCCTCAGCCCAAGGAAGGGTGAGGGGGAAGGGCTGTCAGTTATAT
TAAGGTGGTTGTTGTTGTTGTTTTAAACAAAATGGAGAAGCATAAATAAATAAAAGGGTT
TATCTCAGTTCC

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               TCCCCACATGCTTCCTGACCCTTGACGGCCAAGGGCAAATATGTTGGTACAAAAAGGTTC
AAGAGCCCTGATAACTCCCCGGTTCATACACTACAGGTGCCCCGGTCCCCTGGGCAGGGG
ATTCAGGCTCCATTACCTCCCCAAGGGGCTCTTATGGTCAGCCCCACCCCTGGGGGCCAT
TTCCCCATTAACCACCCCTCAGCCCAAGGAAGGGTGAGGGGGAAGGGCTGTCAGTTATAT
TAAGGTGGTTGTTGTTGTTGTTTTAAACAAAATGGAGAAGCATAAATAAATAAAAGGGTT
TATCTCAGTTCC

Predicted RNA structure(s): 2 entry(ies)

More info

Predicted RNA structure(s): 2 entry(ies)

Help | Less info


               
               41-312, - strand, RNAz p=0.997087
               

               
               128-305, + strand, RNAz p=0.988652

Predicted RNA structure(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               41-312, - strand, RNAz p=0.997087
               

               
               128-305, + strand, RNAz p=0.988652

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               55-310, ip21b08.b1 Brain - Cerebellum Library (DOGEST8) Canis familiaris 
(gb|CK997630.1|), blast E-value=0, identity=95.31% 
               

               
               41-312, BovGen_08271 normal cattle brain Bos taurus cDNA clone (gb|CO879946.1|), 
blast E-value=0, identity=94.49% 
               

               
               55-310, iv26f05.b1 Brain - Cerebellum Library (DOGEST8) Canis familiaris 
(gb|CX004155.1|), blast E-value=0, identity=95.31% 
               

               
               55-310, iv26f05.g1 Brain - Cerebellum Library (DOGEST8) Canis familiaris 
(gb|CX004156.1|), blast E-value=0, identity=95.31% 
               

               
               41-307, LB01714.CR_I07 GC_BGC-17 Bos taurus cDNA clone IMAGE (gb|DV814771.1|), 
blast E-value=0, identity=94.38% 
               

               
               41-307, LB02991.CR_K24 GC_BGC-29 Bos taurus cDNA clone IMAGE (gb|EE370721.1|), 
blast E-value=0, identity=94.38%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               55-310, ip21b08.b1 Brain - Cerebellum Library (DOGEST8) Canis familiaris 
(gb|CK997630.1|), blast E-value=0, identity=95.31% 
               

               
               41-312, BovGen_08271 normal cattle brain Bos taurus cDNA clone (gb|CO879946.1|), 
blast E-value=0, identity=94.49% 
               

               
               55-310, iv26f05.b1 Brain - Cerebellum Library (DOGEST8) Canis familiaris 
(gb|CX004155.1|), blast E-value=0, identity=95.31% 
               

               
               55-310, iv26f05.g1 Brain - Cerebellum Library (DOGEST8) Canis familiaris 
(gb|CX004156.1|), blast E-value=0, identity=95.31% 
               

               
               41-307, LB01714.CR_I07 GC_BGC-17 Bos taurus cDNA clone IMAGE (gb|DV814771.1|), 
blast E-value=0, identity=94.38% 
               

               
               41-307, LB02991.CR_K24 GC_BGC-29 Bos taurus cDNA clone IMAGE (gb|EE370721.1|), 
blast E-value=0, identity=94.38%

Homologous human UTR: 1 entry(ies)

More info

Homologous human UTR: 1 entry(ies)

Help | Less info


               
               3' of BC010704, +

Homologous human UTR: 1 entry(ies)

Help | Less info

Human gene identifier and UTR site,
human gene reading direction


               
               3' of BC010704, +

Aligned organism(s): 6 entry(ies)

More info

Aligned organism(s): 6 entry(ies)

Help | Less info


               
               1-312, gnl|bosTau2|chr25 (24900235-24899929)
               

               
               1-312, gnl|Hg17|chr16 (28792731-28793028)
               

               
               1-312, gnl|Mm7|chr7 (122563866-122563558)
               


               
               128-305, gnl|bosTau2|chr11 (52039716-52039894)
               

               
               128-305, gnl|Hg17|chr16 (28792852-28793021)
               

               
               128-305, gnl|Mm7|chr7 (122563737-122563565)

Aligned organism(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               1-312, gnl|bosTau2|chr25 (24900235-24899929)
               

               
               1-312, gnl|Hg17|chr16 (28792731-28793028)
               

               
               1-312, gnl|Mm7|chr7 (122563866-122563558)
               


               
               128-305, gnl|bosTau2|chr11 (52039716-52039894)
               

               
               128-305, gnl|Hg17|chr16 (28792852-28793021)
               

               
               128-305, gnl|Mm7|chr7 (122563737-122563565)

Expressed library(ies): 2 entry(ies)

More info

Expressed library(ies): 2 entry(ies)

Help | Less info


               
               nms (0.213858)
               

               
               nco (0.161734)

Expressed library(ies): 2 entry(ies)

Help | Less info

Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description


               
               nms (0.213858)
               

               
               nco (0.161734)

	41-312, - strand, RNAz p=0.997087
	128-305, + strand, RNAz p=0.988652

	55-310, ip21b08.b1 Brain - Cerebellum Library (DOGEST8) Canis familiaris (gb\|CK997630.1\|), blast E-value=0, identity=95.31%
	41-312, BovGen_08271 normal cattle brain Bos taurus cDNA clone (gb\|CO879946.1\|), blast E-value=0, identity=94.49%
	55-310, iv26f05.b1 Brain - Cerebellum Library (DOGEST8) Canis familiaris (gb\|CX004155.1\|), blast E-value=0, identity=95.31%
	55-310, iv26f05.g1 Brain - Cerebellum Library (DOGEST8) Canis familiaris (gb\|CX004156.1\|), blast E-value=0, identity=95.31%
	41-307, LB01714.CR_I07 GC_BGC-17 Bos taurus cDNA clone IMAGE (gb\|DV814771.1\|), blast E-value=0, identity=94.38%
	41-307, LB02991.CR_K24 GC_BGC-29 Bos taurus cDNA clone IMAGE (gb\|EE370721.1\|), blast E-value=0, identity=94.38%

	1-312, gnl\|bosTau2\|chr25 (24900235-24899929)
	1-312, gnl\|Hg17\|chr16 (28792731-28793028)
	1-312, gnl\|Mm7\|chr7 (122563866-122563558)

	128-305, gnl\|bosTau2\|chr11 (52039716-52039894)
	128-305, gnl\|Hg17\|chr16 (28792852-28793021)
	128-305, gnl\|Mm7\|chr7 (122563737-122563565)