rcbl0_011756.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CAACCACACTGACCTTTTCTCTATTCCTTAAAATAAACCAAGCCAGCTCCTCCTGGAGGG CTTTGCTCTTGCTCTTTCCTCTGCCTGAGGTGCTCTTCCTTTAGGCGATCCTATGGCTCC CATGTACTTCATTCAGATTCAAATATATCCTCAAAAGAGCCTTTTAAAAACCCACTTCTC ATCATTCTCCATCCCCCTTATCCTGCTTTATTTTTCTTCCTAGTATCATCATTCCTTCCA CTTTGCTGCATATGCATTTGCTACAAATGTACCCTACATACAAAGGG |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CAACCACACTGACCTTTTCTCTATTCCTTAAAATAAACCAAGCCAGCTCCTCCTGGAGGG CTTTGCTCTTGCTCTTTCCTCTGCCTGAGGTGCTCTTCCTTTAGGCGATCCTATGGCTCC CATGTACTTCATTCAGATTCAAATATATCCTCAAAAGAGCCTTTTAAAAACCCACTTCTC ATCATTCTCCATCCCCCTTATCCTGCTTTATTTTTCTTCCTAGTATCATCATTCCTTCCA CTTTGCTGCATATGCATTTGCTACAAATGTACCCTACATACAAAGGG |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 4-192, + strand, RNAz p=0.999642 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 4-192, + strand, RNAz p=0.999642 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 59-182, + strand, RNAmicro p=0.962633 |
| Aligned organism(s): 2 entry(ies) | More info |
| Aligned organism(s): 2 entry(ies) | Help | Less info |
| 4-260, gnl|bosTau2|chr15 (38747452-38747710) | |
| 4-260, gnl|Hg17|chr11 (33854124-33854389) |
| Aligned organism(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 4-260, gnl|bosTau2|chr15 (38747452-38747710) | |
| 4-260, gnl|Hg17|chr11 (33854124-33854389) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| cbl (0.114797) |