rcga34b_c12.y1
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
GTTTCCCAGGCGTGGGCCACAGGGACGGGTCCTGCCTCTGACCCCTACCCGCTGCCCCCA GCCGAGCCAGGCAGCTGGAAGAGGAACTGCGAACCATGGACCAGGCCCTCAAGTCCCTGA TGGCCTCAGAGGAGGAGTATTCCACCAAAGAGGA |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
GTTTCCCAGGCGTGGGCCACAGGGACGGGTCCTGCCTCTGACCCCTACCCGCTGCCCCCA GCCGAGCCAGGCAGCTGGAAGAGGAACTGCGAACCATGGACCAGGCCCTCAAGTCCCTGA TGGCCTCAGAGGAGGAGTATTCCACCAAAGAGGA |
Coded protein: 1 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | Help | Less info |
2-137, gnl|bosTau2|chr8 (28425342-28425205) | |
2-137, gnl|Hg17|chr9 (35675198-35675061) | |
2-137, gnl|Mm7|chr4 (43532955-43532817) |
Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
2-137, gnl|bosTau2|chr8 (28425342-28425205) | |
2-137, gnl|Hg17|chr9 (35675198-35675061) | |
2-137, gnl|Mm7|chr4 (43532955-43532817) |
Expressed library(ies): 1 entry(ies) | More info |
Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
cga (0.279096) |