rcga36b_i10.y1
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
CCTCCATGTGAGCTCTGGGCTGGGGGCTTCCTTGCCCCCACCAGAGGTCCCCCTCTGGTG GGTCTACTCATTCTGCAAAGGACACGATACACAGACCACCCCACAGCCTTATCTCTCTGA TGGACGGGATTCTCAAGTCATCCTGCTGCCTTATTTCTCCCGTGACACGATACAGAAATC ATCCTGCTG |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
CCTCCATGTGAGCTCTGGGCTGGGGGCTTCCTTGCCCCCACCAGAGGTCCCCCTCTGGTG GGTCTACTCATTCTGCAAAGGACACGATACACAGACCACCCCACAGCCTTATCTCTCTGA TGGACGGGATTCTCAAGTCATCCTGCTGCCTTATTTCTCCCGTGACACGATACAGAAATC ATCCTGCTG |
Predicted RNA structure(s): 1 entry(ies) | More info |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
1-118, - strand, RNAz p=0.55998 |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
1-118, - strand, RNAz p=0.55998 |
Aligned organism(s): 3 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | Help | Less info |
1-183, gnl|bosTau2|chr10 (12113988-12113804) | |
1-183, gnl|Hg17|chr15 (71792412-71792603) | |
1-183, gnl|Mm7|chr9 (58554954-58554792) |
Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
1-183, gnl|bosTau2|chr10 (12113988-12113804) | |
1-183, gnl|Hg17|chr15 (71792412-71792603) | |
1-183, gnl|Mm7|chr9 (58554954-58554792) |
Expressed library(ies): 1 entry(ies) | More info |
Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
cga (0.279096) |