rcje03_f10.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CCACCCACACACTGGGGACCCGAGCCCTCTCCAAAGGCAGCCCCGTGGACGGTGGGCGCC AGGGCGAGCGGTGCTTCTGTCAGCAAGCTGAAAGCTGTGGGTCTCTGCCACGGCTCTCAA TTGCTAACAGCTTCTTCTCAGTGCACCTCATTTGCATCTGGGACATCAATTAGCATGTTT GTTGAGGCTAATTGAATGAAACTCAATCATAGCTCTTAATTGCTTGACTATGTGAAAAGA AATCACATTAATGCAGCTAATTAAGTGTACG |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CCACCCACACACTGGGGACCCGAGCCCTCTCCAAAGGCAGCCCCGTGGACGGTGGGCGCC AGGGCGAGCGGTGCTTCTGTCAGCAAGCTGAAAGCTGTGGGTCTCTGCCACGGCTCTCAA TTGCTAACAGCTTCTTCTCAGTGCACCTCATTTGCATCTGGGACATCAATTAGCATGTTT GTTGAGGCTAATTGAATGAAACTCAATCATAGCTCTTAATTGCTTGACTATGTGAAAAGA AATCACATTAATGCAGCTAATTAAGTGTACG |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 15-271, - strand, RNAz p=0.822926 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 15-271, - strand, RNAz p=0.822926 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 113-190, + strand, RNAmicro p=0.970651 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 15-271, gnl|bosTau2|chr3 (82024041-82024294) | |
| 15-271, gnl|Hg17|chr2 (236594581-236594838) | |
| 15-271, gnl|Mm7|chr1 (89643942-89644199) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 15-271, gnl|bosTau2|chr3 (82024041-82024294) | |
| 15-271, gnl|Hg17|chr2 (236594581-236594838) | |
| 15-271, gnl|Mm7|chr1 (89643942-89644199) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| cje (0.165235) |