rcje31_d17.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GCCCAAAGCCTGGGCCCGCTCTTAGGCCCTTAAGTCCTCCAGGCCTGTGGGGGGCGCTGA AGGGCTACTGACTCTCAGGCTGGAGGGAACTCTGACTTGTACTCATCCCTCCAGTCCCCA AAGGGTGCTGATTGCTGCTTTTTCTTTGCCTATTTATTGGTTTCCTAAGGGAGCAAGTCC TCAATGGGGATACAAGATATAAAAAGTATATATATTATTTTTTCATAACTTATGTGGCTT TTAACTTATTGCTTCCCTTCCTGTTTCTGC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GCCCAAAGCCTGGGCCCGCTCTTAGGCCCTTAAGTCCTCCAGGCCTGTGGGGGGCGCTGA AGGGCTACTGACTCTCAGGCTGGAGGGAACTCTGACTTGTACTCATCCCTCCAGTCCCCA AAGGGTGCTGATTGCTGCTTTTTCTTTGCCTATTTATTGGTTTCCTAAGGGAGCAAGTCC TCAATGGGGATACAAGATATAAAAAGTATATATATTATTTTTTCATAACTTATGTGGCTT TTAACTTATTGCTTCCCTTCCTGTTTCTGC |
| Predicted RNA structure(s): 2 entry(ies) | More info |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
| 1-116, - strand, RNAz p=0.785133 | |
| 152-270, + strand, RNAz p=0.686449 |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 1-116, - strand, RNAz p=0.785133 | |
| 152-270, + strand, RNAz p=0.686449 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 5' of NM_182507, + |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-270, gnl|bosTau2|chr5 (19567864-19567596) | |
| 1-270, gnl|Hg17|chr12 (50849972-50849708) | |
| 1-270, gnl|Mm7|chr15 (101334531-101334280) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-270, gnl|bosTau2|chr5 (19567864-19567596) | |
| 1-270, gnl|Hg17|chr12 (50849972-50849708) | |
| 1-270, gnl|Mm7|chr15 (101334531-101334280) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| cje (0.165235) |