rcly19b_n5.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CCAAGATCTGAGGTCAGCGAAGCGAAATGACAGCAGAAGCACTGTCAGAAGACGGCTTGG ACAAGCCCGCCCTGAGATGGCCGATTCCTTCCTTGCATTGGTCTGGGGCAGAATCTGCTG AGACCAGCCGGGGATGGGGAGGCTCGCCGAGAGTGGTGGGATCCAGTGGGGCTGTGGGCT GGATGGGGTGCCTGCAGGGGGAATCAGGGCCAGACTTGGCTGAGGAGCACCCAGGCAGGG CCCAGCCCTGCTCCCTAGAGTAGGGGTAGCCCAGAAAAGGAGGTTAAAGAACAAAGTGCC CCATGATGCAGAAGGGCCGAGGTGAGGGATGAAGTCTGGGGTGGGAACACTGGCCTCCCC AGAATAAAACCATGTTTTCTACTAAAAAAAAAAAAAAAA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CCAAGATCTGAGGTCAGCGAAGCGAAATGACAGCAGAAGCACTGTCAGAAGACGGCTTGG ACAAGCCCGCCCTGAGATGGCCGATTCCTTCCTTGCATTGGTCTGGGGCAGAATCTGCTG AGACCAGCCGGGGATGGGGAGGCTCGCCGAGAGTGGTGGGATCCAGTGGGGCTGTGGGCT GGATGGGGTGCCTGCAGGGGGAATCAGGGCCAGACTTGGCTGAGGAGCACCCAGGCAGGG CCCAGCCCTGCTCCCTAGAGTAGGGGTAGCCCAGAAAAGGAGGTTAAAGAACAAAGTGCC CCATGATGCAGAAGGGCCGAGGTGAGGGATGAAGTCTGGGGTGGGAACACTGGCCTCCCC AGAATAAAACCATGTTTTCTACTAAAAAAAAAAAAAAAA |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 155-374, + strand, RNAz p=0.939189 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 155-374, + strand, RNAz p=0.939189 |
| Predicted microRNA(s): 2 entry(ies) | More info |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
| 170-288, + strand, RNAmicro p=0.999728 | |
| 209-306, - strand, RNAmicro p=0.999523 |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 170-288, + strand, RNAmicro p=0.999728 | |
| 209-306, - strand, RNAmicro p=0.999523 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 3' of AK127224, + |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-381, gnl|bosTau2|chr7 (22029365-22029745) | |
| 1-381, gnl|Hg17|chr5 (177481598-177482008) | |
| 1-381, gnl|Mm7|chr11 (51600388-51599974) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-381, gnl|bosTau2|chr7 (22029365-22029745) | |
| 1-381, gnl|Hg17|chr5 (177481598-177482008) | |
| 1-381, gnl|Mm7|chr11 (51600388-51599974) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| cly (0.120642) |