rcmu39_j5.y1
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
AAGAGTTTATGGTTTCTGGTCTTACATTTTATACGTTTTGATTTTATTTTTGTATGTCAT GTGAGGGAGTGTCCTAGTTTCATTTTTTTTTAACTGTAATtatccacttttcccagaaac acctattgaagagactttcttttctccattgtatattcttgcctcctttgtcatagattg attgaccataagcatgtgagtttatttctgggctctctgttcggttccattgatctatg |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
AAGAGTTTATGGTTTCTGGTCTTACATTTTATACGTTTTGATTTTATTTTTGTATGTCAT GTGAGGGAGTGTCCTAGTTTCATTTTTTTTTAACTGTAATtatccacttttcccagaaac acctattgaagagactttcttttctccattgtatattcttgcctcctttgtcatagattg attgaccataagcatgtgagtttatttctgggctctctgttcggttccattgatctatg |
Aligned organism(s): 1 entry(ies) | More info |
Aligned organism(s): 1 entry(ies) | Help | Less info |
1-238, gnl|bosTau2|chr1 (31106130-31106374) |
Aligned organism(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
1-238, gnl|bosTau2|chr1 (31106130-31106374) |
Expressed library(ies): 1 entry(ies) | More info |
Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
cmu (0.186393) |