rcst13_g20.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TCTCCCTCCATGACCAGGCCTGATTTTGTTAACCACTACTTGAAGTTTTTTGAGGGGGGA ACCTCCAGGGAGACATAGGGGCCTCTCCCTCCTTTCCACCAAAGTAGGGGGTAGGCAACT GGTTGTCATGG |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TCTCCCTCCATGACCAGGCCTGATTTTGTTAACCACTACTTGAAGTTTTTTGAGGGGGGA ACCTCCAGGGAGACATAGGGGCCTCTCCCTCCTTTCCACCAAAGTAGGGGGTAGGCAACT GGTTGTCATGG |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 1-131, + strand, RNAz p=0.8154 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 1-131, + strand, RNAz p=0.8154 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 3' of BC052963, + |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-131, gnl|bosTau2|chr25 (25696743-25696611) | |
| 1-131, gnl|Hg17|chr16 (30658594-30658723) | |
| 1-131, gnl|Mm7|chr7 (123657367-123657493) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-131, gnl|bosTau2|chr25 (25696743-25696611) | |
| 1-131, gnl|Hg17|chr16 (30658594-30658723) | |
| 1-131, gnl|Mm7|chr7 (123657367-123657493) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| cst (0.140036) |