rcte02_k16.y1
| Sequence: | Distiller database | More info | 
| Sequence: | Distiller database | Help | Less info | 
| CAAAACCTACAGGTGCCTTACTTCGTGGATAAAAACTTTGACAATGGCCTACAGAGGAGC CTCTCTGCGTGACCTGGAGAAGACGATAGAGAAGGACTACATTGATTACATCCA | 
| Sequence: | Distiller database | Help | Less info | 
Blue-coloured subsequences are predicted RNA structures by RNAz
| CAAAACCTACAGGTGCCTTACTTCGTGGATAAAAACTTTGACAATGGCCTACAGAGGAGC CTCTCTGCGTGACCTGGAGAAGACGATAGAGAAGGACTACATTGATTACATCCA | 
| Aligned organism(s): 3 entry(ies) | More info | 
| Aligned organism(s): 3 entry(ies) | Help | Less info | 
| 1-114, gnl|bosTau2|chr7 (37317045-37316933) | |
| 1-114, gnl|Hg17|chr5 (138783782-138783670) | |
| 1-114, gnl|Mm7|chr18 (36057008-36056896) | 
| Aligned organism(s): 3 entry(ies) | Help | Less info | 
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-114, gnl|bosTau2|chr7 (37317045-37316933) | |
| 1-114, gnl|Hg17|chr5 (138783782-138783670) | |
| 1-114, gnl|Mm7|chr18 (36057008-36056896) | 
| Expressed library(ies): 1 entry(ies) | More info | 
| Expressed library(ies): 1 entry(ies) | Help | Less info | 
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| cte (0.29274) | 
