Non-Coding RNA Search

rebs35c_e6.y1

Sequence:


               
               CTGCCCCTTCTGTTTCTCCGTTGGTTTCTAGAGCTCTTTCCCTCTCCTCCTCGGAGGGGA
CAGGACTCCTGGGGCCTGGCTGGGGGCCCAGAGCCAGGCCACTCTCTCCTGTTAGCCCTC
AGAGTCCCATTTCTCTCTATTGGTGACCAAGTTGCAAATGGATAAAACACAGGA

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               CTGCCCCTTCTGTTTCTCCGTTGGTTTCTAGAGCTCTTTCCCTCTCCTCCTCGGAGGGGA
CAGGACTCCTGGGGCCTGGCTGGGGGCCCAGAGCCAGGCCACTCTCTCCTGTTAGCCCTC
AGAGTCCCATTTCTCTCTATTGGTGACCAAGTTGCAAATGGATAAAACACAGGA

Predicted RNA structure(s): 1 entry(ies)

More info

Predicted RNA structure(s): 1 entry(ies)

Help | Less info


               
               1-138, - strand, RNAz p=0.999341

Predicted RNA structure(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               1-138, - strand, RNAz p=0.999341

Predicted microRNA(s): 2 entry(ies)

More info

Predicted microRNA(s): 2 entry(ies)

Help | Less info


               
               9-121, + strand, RNAmicro p=0.972793
               

               
               74-178, - strand, RNAmicro p=0.956031

Predicted microRNA(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro


               
               9-121, + strand, RNAmicro p=0.972793
               

               
               74-178, - strand, RNAmicro p=0.956031

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               2-138, ip01f04.b1 Brain - Cerebellum Library (DOGEST8) Canis familiaris 
(gb|CN000605.1|), blast E-value=0, identity=95.62% 
               

               
               2-138, ip40h03.g1 Brain - Cerebellum Library (DOGEST8) Canis familiaris 
(gb|CN003954.1|), blast E-value=0, identity=95.62% 
               

               
               1-138, BovGen_10965 normal cattle brain Bos taurus cDNA clone (gb|CO882640.1|), 
blast E-value=0, identity=97.83% 
               

               
               31-138, BovGen_12436 normal cattle brain Bos taurus cDNA clone (gb|CO884111.1|), 
blast E-value=1.4013e-45, identity=97.22% 
               

               
               1-138, BovGen_13824 normal cattle brain Bos taurus cDNA clone (gb|CO885499.1|), 
blast E-value=0, identity=97.83% 
               

               
               1-138, 1384508 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN538776.1|), 
blast E-value=0, identity=97.83%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               2-138, ip01f04.b1 Brain - Cerebellum Library (DOGEST8) Canis familiaris 
(gb|CN000605.1|), blast E-value=0, identity=95.62% 
               

               
               2-138, ip40h03.g1 Brain - Cerebellum Library (DOGEST8) Canis familiaris 
(gb|CN003954.1|), blast E-value=0, identity=95.62% 
               

               
               1-138, BovGen_10965 normal cattle brain Bos taurus cDNA clone (gb|CO882640.1|), 
blast E-value=0, identity=97.83% 
               

               
               31-138, BovGen_12436 normal cattle brain Bos taurus cDNA clone (gb|CO884111.1|), 
blast E-value=1.4013e-45, identity=97.22% 
               

               
               1-138, BovGen_13824 normal cattle brain Bos taurus cDNA clone (gb|CO885499.1|), 
blast E-value=0, identity=97.83% 
               

               
               1-138, 1384508 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN538776.1|), 
blast E-value=0, identity=97.83%

Aligned organism(s): 3 entry(ies)

More info

Aligned organism(s): 3 entry(ies)

Help | Less info


               
               1-174, gnl|bosTau2|chr25 (22887761-22887588)
               

               
               1-174, gnl|Hg17|chr16 (30908387-30908192)
               

               
               1-174, gnl|Mm7|chr7 (123900745-123900574)

Aligned organism(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               1-174, gnl|bosTau2|chr25 (22887761-22887588)
               

               
               1-174, gnl|Hg17|chr16 (30908387-30908192)
               

               
               1-174, gnl|Mm7|chr7 (123900745-123900574)

Expressed library(ies): 1 entry(ies)

More info

Expressed library(ies): 1 entry(ies)

Help | Less info


               
               ebs (0.118301)

Expressed library(ies): 1 entry(ies)

Help | Less info

Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description


               
               ebs (0.118301)

	9-121, + strand, RNAmicro p=0.972793
	74-178, - strand, RNAmicro p=0.956031

	2-138, ip01f04.b1 Brain - Cerebellum Library (DOGEST8) Canis familiaris (gb\|CN000605.1\|), blast E-value=0, identity=95.62%
	2-138, ip40h03.g1 Brain - Cerebellum Library (DOGEST8) Canis familiaris (gb\|CN003954.1\|), blast E-value=0, identity=95.62%
	1-138, BovGen_10965 normal cattle brain Bos taurus cDNA clone (gb\|CO882640.1\|), blast E-value=0, identity=97.83%
	31-138, BovGen_12436 normal cattle brain Bos taurus cDNA clone (gb\|CO884111.1\|), blast E-value=1.4013e-45, identity=97.22%
	1-138, BovGen_13824 normal cattle brain Bos taurus cDNA clone (gb\|CO885499.1\|), blast E-value=0, identity=97.83%
	1-138, 1384508 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb\|DN538776.1\|), blast E-value=0, identity=97.83%

	1-174, gnl\|bosTau2\|chr25 (22887761-22887588)
	1-174, gnl\|Hg17\|chr16 (30908387-30908192)
	1-174, gnl\|Mm7\|chr7 (123900745-123900574)