reep30c_n9.y1
|
GCCCGCACAGGATGCTGGCCCCTGCCTGGTTAGGGGCACTCAGTCAAGGCCAGTCCTTTC
CTGGGTATTTATTCTCTATTTATTGGGGACAGGAGAAGAAGAGCCCCACCTGGGTGGGGC
AGCTCCTCCAGCCCTTCCTTCCCTCCCTGCCTGGCCACTCTACCTCCTCTTT
|
Blue-coloured subsequences are predicted RNA structures by RNAz
|
GCCCGCACAGGATGCTGGCCCCTGCCTGGTTAGGGGCACTCAGTCAAGGCCAGTCCTTTC
CTGGGTATTTATTCTCTATTTATTGGGGACAGGAGAAGAAGAGCCCCACCTGGGTGGGGC
AGCTCCTCCAGCCCTTCCTTCCCTCCCTGCCTGGCCACTCTACCTCCTCTTT
|
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
|
5-171, 193646 MARC 2BOV Bos taurus cDNA 5', mRNA sequence (gb|BE723733.1|),
blast E-value=1.4013e-45, identity=89.88% |
|
6-157, UI-E-EO1-aja-n-21-0-UI.s1 UI-E-EO1 Homo sapiens cDNA clone
(gb|BU741943.1|), blast E-value=2e-22, identity=84.97% |
|
6-157, AGENCOURT_10473651 NIH_MGC_107 Homo sapiens cDNA clone (gb|BU856852.1|),
blast E-value=2e-22, identity=84.97% |
|
5-129, 4099045 BARC 10BOV Bos taurus cDNA clone 10BOV5_H12 3', mRNA
(gb|CK958330.1|), blast E-value=4e-30, identity=89.68% |
|
5-156, 4099429 BARC 10BOV Bos taurus cDNA clone 10BOV5_H12 5', mRNA
(gb|CK958599.1|), blast E-value=1.99993e-41, identity=90.2% |
|
5-171, BovGen_10368 normal cattle brain Bos taurus cDNA clone (gb|CO882043.1|),
blast E-value=1.4013e-45, identity=89.88% |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
|
5-171, 193646 MARC 2BOV Bos taurus cDNA 5', mRNA sequence (gb|BE723733.1|),
blast E-value=1.4013e-45, identity=89.88% |
|
6-157, UI-E-EO1-aja-n-21-0-UI.s1 UI-E-EO1 Homo sapiens cDNA clone
(gb|BU741943.1|), blast E-value=2e-22, identity=84.97% |
|
6-157, AGENCOURT_10473651 NIH_MGC_107 Homo sapiens cDNA clone (gb|BU856852.1|),
blast E-value=2e-22, identity=84.97% |
|
5-129, 4099045 BARC 10BOV Bos taurus cDNA clone 10BOV5_H12 3', mRNA
(gb|CK958330.1|), blast E-value=4e-30, identity=89.68% |
|
5-156, 4099429 BARC 10BOV Bos taurus cDNA clone 10BOV5_H12 5', mRNA
(gb|CK958599.1|), blast E-value=1.99993e-41, identity=90.2% |
|
5-171, BovGen_10368 normal cattle brain Bos taurus cDNA clone (gb|CO882043.1|),
blast E-value=1.4013e-45, identity=89.88% |
Human gene identifier and UTR site,
human gene reading direction
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map