reep35c_m19.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TGGATATCCCTCACAAACTGACCCTGGCCCCCTAAAACACCCCACAGTCACCTTCAAGCT GTACGACACGGACAGAAATGGGATCCTGGACAGCTCAGTGAGTTGGGGGACCTGTATGCT GGGCAAGGGAGTATGTGTCCATTTGTCTGTGCTCTCCTGTCCCAACTCTTCCAGGATCTT AAGAAAGAGAGGAAGCTAGAGGGAGAAGTTGAGTCTAGTAGGACTAAATTTGGGAGCAGG CCCC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TGGATATCCCTCACAAACTGACCCTGGCCCCCTAAAACACCCCACAGTCACCTTCAAGCT GTACGACACGGACAGAAATGGGATCCTGGACAGCTCAGTGAGTTGGGGGACCTGTATGCT GGGCAAGGGAGTATGTGTCCATTTGTCTGTGCTCTCCTGTCCCAACTCTTCCAGGATCTT AAGAAAGAGAGGAAGCTAGAGGGAGAAGTTGAGTCTAGTAGGACTAAATTTGGGAGCAGG CCCC |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 79-244, + strand, RNAz p=0.69441 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 79-244, + strand, RNAz p=0.69441 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 80-182, + strand, RNAmicro p=0.991082 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 3' of AF064771, + |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-244, gnl|bosTau2|chr5 (33663437-33663204) | |
| 1-244, gnl|Hg17|chr12 (54618514-54618758) | |
| 1-244, gnl|Mm7|chr10 (128235950-128235749) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-244, gnl|bosTau2|chr5 (33663437-33663204) | |
| 1-244, gnl|Hg17|chr12 (54618514-54618758) | |
| 1-244, gnl|Mm7|chr10 (128235950-128235749) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| eep (0.122564) |