rfbs3906b_f17.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| AAAACAAAAACTAACAAAAAAAAAATTCGAGTGTTCATTTTTCGTTTCGTTTAATCCGAG CTCCGGCTCGGTTCCCGGCCAAGCTCGAGGGGTCTACGCTCCCACGCGCACGCGGATGGG AAGGGCTTTTGCCCGGCCGCAGACCGACCACCGCACATCAGGGCCCCCGCTCCCCGCGGG GCCCTGCCCTCCTGGCTACAAACAA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| AAAACAAAAACTAACAAAAAAAAAATTCGAGTGTTCATTTTTCGTTTCGTTTAATCCGAG CTCCGGCTCGGTTCCCGGCCAAGCTCGAGGGGTCTACGCTCCCACGCGCACGCGGATGGG AAGGGCTTTTGCCCGGCCGCAGACCGACCACCGCACATCAGGGCCCCCGCTCCCCGCGGG GCCCTGCCCTCCTGGCTACAAACAA |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 38-205, - strand, RNAz p=0.59691 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 38-205, - strand, RNAz p=0.59691 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-205, gnl|bosTau2|chr3 (74634196-74634401) | |
| 1-205, gnl|Hg17|chr1 (38179370-38179170) | |
| 1-205, gnl|Mm7|chr4 (124104512-124104718) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-205, gnl|bosTau2|chr3 (74634196-74634401) | |
| 1-205, gnl|Hg17|chr1 (38179370-38179170) | |
| 1-205, gnl|Mm7|chr4 (124104512-124104718) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| fbs (0.175346) |