Non-Coding RNA Search

rfbs3926b_p8.y1

Sequence:


               
               GGAAGGGAGGACAGCATGGGCGGAGGTCTGGTCCCTTGGGGTCCGGCGATGAGGGCCTCA
GGCTCAGAGTTAGGGGCCAAGGAGGCCTCTGTCATTTTAAGACTCGTGTTTACAGTTTTG
TATGCAAAAAAAAAAAAAAAAAAA

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               GGAAGGGAGGACAGCATGGGCGGAGGTCTGGTCCCTTGGGGTCCGGCGATGAGGGCCTCA
GGCTCAGAGTTAGGGGCCAAGGAGGCCTCTGTCATTTTAAGACTCGTGTTTACAGTTTTG
TATGCAAAAAAAAAAAAAAAAAAA

Predicted RNA structure(s): 2 entry(ies)

More info

Predicted RNA structure(s): 2 entry(ies)

Help | Less info


               
               3-127, + strand, RNAz p=0.994419
               

               
               11-127, - strand, RNAz p=0.993767

Predicted RNA structure(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               3-127, + strand, RNAz p=0.994419
               

               
               11-127, - strand, RNAz p=0.993767

Homologous human UTR: 1 entry(ies)

More info

Homologous human UTR: 1 entry(ies)

Help | Less info


               
               3' of NM_025268, +

Homologous human UTR: 1 entry(ies)

Help | Less info

Human gene identifier and UTR site,
human gene reading direction


               
               3' of NM_025268, +

Aligned organism(s): 10 entry(ies)

More info

Aligned organism(s): 10 entry(ies)

Help | Less info


               
               3-127, gnl|bosTau2|chr21 (49340587-49340462)
               

               
               3-127, gnl|canFam2|chr8 (75868507-75868661)
               

               
               3-127, gnl|hg17|chr14 (105067348-105067532)
               

               
               3-127, gnl|Hg17|chr14 (105067466-105067580)
               

               
               3-127, gnl|mm7|chr12 (110714410-110714591)
               

               
               3-127, gnl|Mm7|chr12 (110714524-110714639)
               

               
               3-127, gnl|monDom2|scaffold_6 (103116435-103116250)
               

               
               3-127, gnl|rheMac2|chr7 (168893906-168894091)
               

               
               3-127, gnl|rn3|chr6 (138198128-138198313)
               

               
               3-127, gnl|xenTro1|scaffold_4596 (7467-7293)

Aligned organism(s): 10 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               3-127, gnl|bosTau2|chr21 (49340587-49340462)
               

               
               3-127, gnl|canFam2|chr8 (75868507-75868661)
               

               
               3-127, gnl|hg17|chr14 (105067348-105067532)
               

               
               3-127, gnl|Hg17|chr14 (105067466-105067580)
               

               
               3-127, gnl|mm7|chr12 (110714410-110714591)
               

               
               3-127, gnl|Mm7|chr12 (110714524-110714639)
               

               
               3-127, gnl|monDom2|scaffold_6 (103116435-103116250)
               

               
               3-127, gnl|rheMac2|chr7 (168893906-168894091)
               

               
               3-127, gnl|rn3|chr6 (138198128-138198313)
               

               
               3-127, gnl|xenTro1|scaffold_4596 (7467-7293)

Expressed library(ies): 1 entry(ies)

More info

Expressed library(ies): 1 entry(ies)

Help | Less info


               
               fbs (0.175346)

Expressed library(ies): 1 entry(ies)

Help | Less info

Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description


               
               fbs (0.175346)

	3-127, + strand, RNAz p=0.994419
	11-127, - strand, RNAz p=0.993767

	3-127, gnl\|bosTau2\|chr21 (49340587-49340462)
	3-127, gnl\|canFam2\|chr8 (75868507-75868661)
	3-127, gnl\|hg17\|chr14 (105067348-105067532)
	3-127, gnl\|Hg17\|chr14 (105067466-105067580)
	3-127, gnl\|mm7\|chr12 (110714410-110714591)
	3-127, gnl\|Mm7\|chr12 (110714524-110714639)
	3-127, gnl\|monDom2\|scaffold_6 (103116435-103116250)
	3-127, gnl\|rheMac2\|chr7 (168893906-168894091)
	3-127, gnl\|rn3\|chr6 (138198128-138198313)
	3-127, gnl\|xenTro1\|scaffold_4596 (7467-7293)