rfcc26b_d11.y1
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
CTGGGCCTCTCCCCTTTCCCAGCTGCTGGGAAGGGGAGATGGGGGCTTCCCCTCACCACA CCTGTGGCTGTTCCCACATCCCCTTGAGTATCCCAGGAAAAATAAAACGGCAGAACTGCA AAAAAAAAAAAA |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
CTGGGCCTCTCCCCTTTCCCAGCTGCTGGGAAGGGGAGATGGGGGCTTCCCCTCACCACA CCTGTGGCTGTTCCCACATCCCCTTGAGTATCCCAGGAAAAATAAAACGGCAGAACTGCA AAAAAAAAAAAA |
Predicted RNA structure(s): 1 entry(ies) | More info |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
1-120, - strand, RNAz p=0.977788 |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
1-120, - strand, RNAz p=0.977788 |
Aligned organism(s): 3 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | Help | Less info |
1-120, gnl|bosTau2|chr3 (77958691-77958811) | |
1-120, gnl|Hg17|chr1 (35000249-35000130) | |
1-120, gnl|Mm7|chr4 (126681546-126681664) |
Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
1-120, gnl|bosTau2|chr3 (77958691-77958811) | |
1-120, gnl|Hg17|chr1 (35000249-35000130) | |
1-120, gnl|Mm7|chr4 (126681546-126681664) |
Expressed library(ies): 1 entry(ies) | More info |
Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
fcc (0.197785) |