rfcc27b_j9.y1
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
TCATTGGTCAGCACTCTTCGATGAAAGACAGACCTAATGACTGGCATTTGAGATGCTGCT GGCATTTTGAATTCAACATCTGCTGAAAAAACGGTAAAACTAAT |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
TCATTGGTCAGCACTCTTCGATGAAAGACAGACCTAATGACTGGCATTTGAGATGCTGCT GGCATTTTGAATTCAACATCTGCTGAAAAAACGGTAAAACTAAT |
Aligned organism(s): 3 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | Help | Less info |
1-104, gnl|bosTau2|chr12 (40612805-40612906) | |
1-104, gnl|Hg17|chr13 (83349945-83349844) | |
1-104, gnl|Mm7|chr14 (103307947-103307846) |
Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
1-104, gnl|bosTau2|chr12 (40612805-40612906) | |
1-104, gnl|Hg17|chr13 (83349945-83349844) | |
1-104, gnl|Mm7|chr14 (103307947-103307846) |
Expressed library(ies): 1 entry(ies) | More info |
Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
fcc (0.197785) |