rfce30c_j22.y1
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
TCTCATACATCCGGGAGCAATATGTGCTGACCCACTGCTCTGCCAGCCCAGAGCCAGGCC CAGGTTCCACAGGCAGCAGTGAGTCCCCCATCTCCCAGGGCCCTGGTTCGCCTGAAGGCA GTGCTCCCCTGGACCCCCCTTCTCAGCAGGGTTGCCGCAGCCTGGCCTGGGGAGAACCTG CAGGCTCCCGCTCCTGCCCCCTGCCTCCACCCCCACTGGCAACAGTCAAGGTGAGATTTA GTCCCCATCCACCTACTATGTATCTAGCAAATGTTTATTGGCCACCTGCTACATGCCGTA AATTATGCAATGGTTACTAGTAAGTATAGTTTT |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
TCTCATACATCCGGGAGCAATATGTGCTGACCCACTGCTCTGCCAGCCCAGAGCCAGGCC CAGGTTCCACAGGCAGCAGTGAGTCCCCCATCTCCCAGGGCCCTGGTTCGCCTGAAGGCA GTGCTCCCCTGGACCCCCCTTCTCAGCAGGGTTGCCGCAGCCTGGCCTGGGGAGAACCTG CAGGCTCCCGCTCCTGCCCCCTGCCTCCACCCCCACTGGCAACAGTCAAGGTGAGATTTA GTCCCCATCCACCTACTATGTATCTAGCAAATGTTTATTGGCCACCTGCTACATGCCGTA AATTATGCAATGGTTACTAGTAAGTATAGTTTT |
Predicted RNA structure(s): 2 entry(ies) | More info |
Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
2-160, - strand, RNAz p=0.648041 | |
201-331, - strand, RNAz p=0.89631 |
Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
2-160, - strand, RNAz p=0.648041 | |
201-331, - strand, RNAz p=0.89631 |
Predicted microRNA(s): 2 entry(ies) | More info |
Predicted microRNA(s): 2 entry(ies) | Help | Less info |
76-181, + strand, RNAmicro p=0.98865 | |
78-167, - strand, RNAmicro p=0.987272 |
Predicted microRNA(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
76-181, + strand, RNAmicro p=0.98865 | |
78-167, - strand, RNAmicro p=0.987272 |
Aligned organism(s): 3 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | Help | Less info |
2-331, gnl|bosTau2|chr1 (51230432-51230106) | |
2-331, gnl|Hg17|chr3 (185439135-185439464) | |
2-331, gnl|Mm7|chr16 (20150993-20151295) |
Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
2-331, gnl|bosTau2|chr1 (51230432-51230106) | |
2-331, gnl|Hg17|chr3 (185439135-185439464) | |
2-331, gnl|Mm7|chr16 (20150993-20151295) |
Expressed library(ies): 1 entry(ies) | More info |
Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
fce (0.271592) |