rfhi4011b_d2.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GGACCTCTCTTGTGCTGGGACCTCAGAGACCTGTCCCCGCACCTCCTGTGCTGTCCATTT TGCAGATGGGAACACTGGGGCAAAGCGGAGACAGCCCAGAGTTGCCCTAACTCTGCTGCC CAGGTGGAGAGGGAGGAGAGCTCCCTGAGAGGCTCATCCACATTGTGACCCCTGCTGTCC TCTGAACATCCTTTCCTAAGAACTGTCAAGGACCAAAGTCATCTTTTGCTGACACATGTT GCTTTTCTCTTTGCCTTTTTTTTTTTTTT |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GGACCTCTCTTGTGCTGGGACCTCAGAGACCTGTCCCCGCACCTCCTGTGCTGTCCATTT TGCAGATGGGAACACTGGGGCAAAGCGGAGACAGCCCAGAGTTGCCCTAACTCTGCTGCC CAGGTGGAGAGGGAGGAGAGCTCCCTGAGAGGCTCATCCACATTGTGACCCCTGCTGTCC TCTGAACATCCTTTCCTAAGAACTGTCAAGGACCAAAGTCATCTTTTGCTGACACATGTT GCTTTTCTCTTTGCCTTTTTTTTTTTTTT |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 37-187, + strand, RNAz p=0.999744 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 37-187, + strand, RNAz p=0.999744 |
| Predicted microRNA(s): 2 entry(ies) | More info |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
| 86-186, - strand, RNAmicro p=0.994212 | |
| 94-176, + strand, RNAmicro p=0.987495 |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 86-186, - strand, RNAmicro p=0.994212 | |
| 94-176, + strand, RNAmicro p=0.987495 |
| Aligned organism(s): 2 entry(ies) | More info |
| Aligned organism(s): 2 entry(ies) | Help | Less info |
| 1-267, gnl|bosTau2|chr7 (4807690-4807964) | |
| 1-267, gnl|Hg17|chr19 (17573863-17573619) |
| Aligned organism(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-267, gnl|bosTau2|chr7 (4807690-4807964) | |
| 1-267, gnl|Hg17|chr19 (17573863-17573619) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| fhi (0.169578) |