Non-Coding RNA Search

rfhi4017b_m14.y1

Sequence:


               
               GCGCGCGGGCGGGCGCGTGTGTGCGCGCAAGAGCTCCAGTGCAGGAGACACTGGGTGTGC
GTGCGTGTGTTATGGGTTTGATTCCAGAGCAGGTTGCACATTGGTCCTGGGTGGCTCGCA
GGCTCAGGTCGCGCTTGGGCGTCCTCCTCCTAATCGTTTCCGAAGTAGCAGCAGCACCAG
CAGCAGCAGCCGCCGCGGCAGCAGCATCGGCAGCGTTGGCAGCAGCTCCGCGGCACAGCC
GGCAGAACTGTGCAGAAGCGAGCACCGTTTGGGGAGTCCGGGGGGCGGGTAAGAGGGAGG
AGGGGGAAAGCCTGATTTGGTCTTTGGGATTATTTTTCCCCTTCTTTCCCTCTCTCTCTT
TCTTGAGGGTGTGTGTTGCCCCCTCGAAGTGAAGGAATTTTGCTCCAGAGCGAGCTGGGA
CCGAAGACTCTAGGCTAAGTTATCTCTCTATGTAGATGG

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               GCGCGCGGGCGGGCGCGTGTGTGCGCGCAAGAGCTCCAGTGCAGGAGACACTGGGTGTGC
GTGCGTGTGTTATGGGTTTGATTCCAGAGCAGGTTGCACATTGGTCCTGGGTGGCTCGCA
GGCTCAGGTCGCGCTTGGGCGTCCTCCTCCTAATCGTTTCCGAAGTAGCAGCAGCACCAG
CAGCAGCAGCCGCCGCGGCAGCAGCATCGGCAGCGTTGGCAGCAGCTCCGCGGCACAGCC
GGCAGAACTGTGCAGAAGCGAGCACCGTTTGGGGAGTCCGGGGGGCGGGTAAGAGGGAGG
AGGGGGAAAGCCTGATTTGGTCTTTGGGATTATTTTTCCCCTTCTTTCCCTCTCTCTCTT
TCTTGAGGGTGTGTGTTGCCCCCTCGAAGTGAAGGAATTTTGCTCCAGAGCGAGCTGGGA
CCGAAGACTCTAGGCTAAGTTATCTCTCTATGTAGATGG

Predicted RNA structure(s): 4 entry(ies)

More info

Predicted RNA structure(s): 4 entry(ies)

Help | Less info


               
               1-118, - strand, RNAz p=0.926062
               

               
               28-142, + strand, RNAz p=0.650107
               

               
               159-447, - strand, RNAz p=0.987013
               

               
               273-430, - strand, RNAz p=0.999391

Predicted RNA structure(s): 4 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               1-118, - strand, RNAz p=0.926062
               

               
               28-142, + strand, RNAz p=0.650107
               

               
               159-447, - strand, RNAz p=0.987013
               

               
               273-430, - strand, RNAz p=0.999391

Predicted microRNA(s): 3 entry(ies)

More info

Predicted microRNA(s): 3 entry(ies)

Help | Less info


               
               289-404, + strand, RNAmicro p=0.990112
               

               
               31-126, + strand, RNAmicro p=0.985019
               

               
               214-283, + strand, RNAmicro p=0.93924

Predicted microRNA(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro


               
               289-404, + strand, RNAmicro p=0.990112
               

               
               31-126, + strand, RNAmicro p=0.985019
               

               
               214-283, + strand, RNAmicro p=0.93924

Similar Transcript(s): 12 entry(ies)

More info

Similar Transcript(s): 12 entry(ies)

Help | Less info


               
               245-447, CJ122840 RIKEN full-length enriched mouse cDNA library, C57BL/6 
(dbj|CJ122840.1|), blast E-value=0, identity=92.34% 
               

               
               245-447, CJ123164 RIKEN full-length enriched mouse cDNA library, C57BL/6J 
(dbj|CJ123164.1|), blast E-value=0, identity=92.34% 
               

               
               245-447, CJ124812 RIKEN full-length enriched mouse cDNA library, C57BL/6 
(dbj|CJ124812.1|), blast E-value=0, identity=92.34% 
               

               
               245-447, CJ125973 RIKEN full-length enriched mouse cDNA library, C57BL/6 
(dbj|CJ125973.1|), blast E-value=0, identity=92.34% 
               

               
               224-445, DA110033 BRACE3 Homo sapiens cDNA clone BRACE3026863 5', mRNA 
(dbj|DA110033.1|), blast E-value=0, identity=95.59% 
               

               
               219-447, 222465 MARC 2BOV Bos taurus cDNA 5', mRNA sequence (gb|BF074893.1|), 
blast E-value=0, identity=94.81% 
               

               
               279-430, CJ122840 RIKEN full-length enriched mouse cDNA library, C57BL/6 
(dbj|CJ122840.1|), blast E-value=0, identity=92.9% 
               

               
               279-430, CJ123164 RIKEN full-length enriched mouse cDNA library, C57BL/6J 
(dbj|CJ123164.1|), blast E-value=0, identity=92.9% 
               

               
               279-430, CJ124812 RIKEN full-length enriched mouse cDNA library, C57BL/6 
(dbj|CJ124812.1|), blast E-value=0, identity=92.9% 
               

               
               279-430, CJ125973 RIKEN full-length enriched mouse cDNA library, C57BL/6 
(dbj|CJ125973.1|), blast E-value=0, identity=92.9% 
               

               
               273-430, DA110033 BRACE3 Homo sapiens cDNA clone BRACE3026863 5', mRNA 
(dbj|DA110033.1|), blast E-value=0, identity=95.09% 
               

               
               273-430, 222465 MARC 2BOV Bos taurus cDNA 5', mRNA sequence (gb|BF074893.1|), 
blast E-value=0, identity=93.75%

Similar Transcript(s): 12 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               245-447, CJ122840 RIKEN full-length enriched mouse cDNA library, C57BL/6 
(dbj|CJ122840.1|), blast E-value=0, identity=92.34% 
               

               
               245-447, CJ123164 RIKEN full-length enriched mouse cDNA library, C57BL/6J 
(dbj|CJ123164.1|), blast E-value=0, identity=92.34% 
               

               
               245-447, CJ124812 RIKEN full-length enriched mouse cDNA library, C57BL/6 
(dbj|CJ124812.1|), blast E-value=0, identity=92.34% 
               

               
               245-447, CJ125973 RIKEN full-length enriched mouse cDNA library, C57BL/6 
(dbj|CJ125973.1|), blast E-value=0, identity=92.34% 
               

               
               224-445, DA110033 BRACE3 Homo sapiens cDNA clone BRACE3026863 5', mRNA 
(dbj|DA110033.1|), blast E-value=0, identity=95.59% 
               

               
               219-447, 222465 MARC 2BOV Bos taurus cDNA 5', mRNA sequence (gb|BF074893.1|), 
blast E-value=0, identity=94.81% 
               

               
               279-430, CJ122840 RIKEN full-length enriched mouse cDNA library, C57BL/6 
(dbj|CJ122840.1|), blast E-value=0, identity=92.9% 
               

               
               279-430, CJ123164 RIKEN full-length enriched mouse cDNA library, C57BL/6J 
(dbj|CJ123164.1|), blast E-value=0, identity=92.9% 
               

               
               279-430, CJ124812 RIKEN full-length enriched mouse cDNA library, C57BL/6 
(dbj|CJ124812.1|), blast E-value=0, identity=92.9% 
               

               
               279-430, CJ125973 RIKEN full-length enriched mouse cDNA library, C57BL/6 
(dbj|CJ125973.1|), blast E-value=0, identity=92.9% 
               

               
               273-430, DA110033 BRACE3 Homo sapiens cDNA clone BRACE3026863 5', mRNA 
(dbj|DA110033.1|), blast E-value=0, identity=95.09% 
               

               
               273-430, 222465 MARC 2BOV Bos taurus cDNA 5', mRNA sequence (gb|BF074893.1|), 
blast E-value=0, identity=93.75%

Aligned organism(s): 12 entry(ies)

More info

Aligned organism(s): 12 entry(ies)

Help | Less info


               
               1-459, gnl|bosTau2|chr7 (50573641-50574099)
               

               
               1-459, gnl|canFam2|chr4 (47869818-47869386)
               

               
               1-459, gnl|hg17|chr5 (166338512-166338918)
               

               
               1-459, gnl|Hg17|chr5 (166338596-166339073)
               

               
               1-459, gnl|loxAfr1|scaffold_774 (29229-28789)
               

               
               1-459, gnl|mm7|chr11 (37090176-37089747)
               

               
               1-459, gnl|Mm7|chr11 (37090040-37089588)
               

               
               1-459, gnl|monDom2|scaffold_6 (35181706-35181290)
               

               
               1-459, gnl|oryCun1|scaffold_215290 (391412-390962)
               

               
               1-459, gnl|panTro1|chr4 (173574493-173574879)
               

               
               1-459, gnl|rheMac2|chr6 (163339481-163339883)
               

               
               1-459, gnl|rn3|chr10 (22188166-22187722)

Aligned organism(s): 12 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               1-459, gnl|bosTau2|chr7 (50573641-50574099)
               

               
               1-459, gnl|canFam2|chr4 (47869818-47869386)
               

               
               1-459, gnl|hg17|chr5 (166338512-166338918)
               

               
               1-459, gnl|Hg17|chr5 (166338596-166339073)
               

               
               1-459, gnl|loxAfr1|scaffold_774 (29229-28789)
               

               
               1-459, gnl|mm7|chr11 (37090176-37089747)
               

               
               1-459, gnl|Mm7|chr11 (37090040-37089588)
               

               
               1-459, gnl|monDom2|scaffold_6 (35181706-35181290)
               

               
               1-459, gnl|oryCun1|scaffold_215290 (391412-390962)
               

               
               1-459, gnl|panTro1|chr4 (173574493-173574879)
               

               
               1-459, gnl|rheMac2|chr6 (163339481-163339883)
               

               
               1-459, gnl|rn3|chr10 (22188166-22187722)

Expressed library(ies): 1 entry(ies)

More info

Expressed library(ies): 1 entry(ies)

Help | Less info


               
               fhi (0.169578)

Expressed library(ies): 1 entry(ies)

Help | Less info

Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description


               
               fhi (0.169578)

	1-118, - strand, RNAz p=0.926062
	28-142, + strand, RNAz p=0.650107
	159-447, - strand, RNAz p=0.987013
	273-430, - strand, RNAz p=0.999391

	289-404, + strand, RNAmicro p=0.990112
	31-126, + strand, RNAmicro p=0.985019
	214-283, + strand, RNAmicro p=0.93924

	245-447, CJ122840 RIKEN full-length enriched mouse cDNA library, C57BL/6 (dbj\|CJ122840.1\|), blast E-value=0, identity=92.34%
	245-447, CJ123164 RIKEN full-length enriched mouse cDNA library, C57BL/6J (dbj\|CJ123164.1\|), blast E-value=0, identity=92.34%
	245-447, CJ124812 RIKEN full-length enriched mouse cDNA library, C57BL/6 (dbj\|CJ124812.1\|), blast E-value=0, identity=92.34%
	245-447, CJ125973 RIKEN full-length enriched mouse cDNA library, C57BL/6 (dbj\|CJ125973.1\|), blast E-value=0, identity=92.34%
	224-445, DA110033 BRACE3 Homo sapiens cDNA clone BRACE3026863 5', mRNA (dbj\|DA110033.1\|), blast E-value=0, identity=95.59%
	219-447, 222465 MARC 2BOV Bos taurus cDNA 5', mRNA sequence (gb\|BF074893.1\|), blast E-value=0, identity=94.81%
	279-430, CJ122840 RIKEN full-length enriched mouse cDNA library, C57BL/6 (dbj\|CJ122840.1\|), blast E-value=0, identity=92.9%
	279-430, CJ123164 RIKEN full-length enriched mouse cDNA library, C57BL/6J (dbj\|CJ123164.1\|), blast E-value=0, identity=92.9%
	279-430, CJ124812 RIKEN full-length enriched mouse cDNA library, C57BL/6 (dbj\|CJ124812.1\|), blast E-value=0, identity=92.9%
	279-430, CJ125973 RIKEN full-length enriched mouse cDNA library, C57BL/6 (dbj\|CJ125973.1\|), blast E-value=0, identity=92.9%
	273-430, DA110033 BRACE3 Homo sapiens cDNA clone BRACE3026863 5', mRNA (dbj\|DA110033.1\|), blast E-value=0, identity=95.09%
	273-430, 222465 MARC 2BOV Bos taurus cDNA 5', mRNA sequence (gb\|BF074893.1\|), blast E-value=0, identity=93.75%

	1-459, gnl\|bosTau2\|chr7 (50573641-50574099)
	1-459, gnl\|canFam2\|chr4 (47869818-47869386)
	1-459, gnl\|hg17\|chr5 (166338512-166338918)
	1-459, gnl\|Hg17\|chr5 (166338596-166339073)
	1-459, gnl\|loxAfr1\|scaffold_774 (29229-28789)
	1-459, gnl\|mm7\|chr11 (37090176-37089747)
	1-459, gnl\|Mm7\|chr11 (37090040-37089588)
	1-459, gnl\|monDom2\|scaffold_6 (35181706-35181290)
	1-459, gnl\|oryCun1\|scaffold_215290 (391412-390962)
	1-459, gnl\|panTro1\|chr4 (173574493-173574879)
	1-459, gnl\|rheMac2\|chr6 (163339481-163339883)
	1-459, gnl\|rn3\|chr10 (22188166-22187722)